ID: 1065193716

View in Genome Browser
Species Human (GRCh38)
Location 10:23240099-23240121
Sequence GAGGTTCACCTGAGTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065193710_1065193716 2 Left 1065193710 10:23240074-23240096 CCAGCAATTCAGAAGGCTGAGGT No data
Right 1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG No data
1065193708_1065193716 3 Left 1065193708 10:23240073-23240095 CCCAGCAATTCAGAAGGCTGAGG No data
Right 1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG No data
1065193706_1065193716 11 Left 1065193706 10:23240065-23240087 CCTGTAGTCCCAGCAATTCAGAA No data
Right 1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065193716 Original CRISPR GAGGTTCACCTGAGTCTGGG AGG Intergenic
No off target data available for this crispr