ID: 1065196495

View in Genome Browser
Species Human (GRCh38)
Location 10:23270909-23270931
Sequence GAGTTCTGTACATATAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 6, 2: 21, 3: 71, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065196495_1065196502 22 Left 1065196495 10:23270909-23270931 CCAGGGTTATATGTACAGAACTC 0: 1
1: 6
2: 21
3: 71
4: 255
Right 1065196502 10:23270954-23270976 CCCAATTAAAAGACATAAAATGG No data
1065196495_1065196504 30 Left 1065196495 10:23270909-23270931 CCAGGGTTATATGTACAGAACTC 0: 1
1: 6
2: 21
3: 71
4: 255
Right 1065196504 10:23270962-23270984 AAAGACATAAAATGGCAAGTTGG No data
1065196495_1065196497 -8 Left 1065196495 10:23270909-23270931 CCAGGGTTATATGTACAGAACTC 0: 1
1: 6
2: 21
3: 71
4: 255
Right 1065196497 10:23270924-23270946 CAGAACTCTGATCTCTCCCTGGG No data
1065196495_1065196496 -9 Left 1065196495 10:23270909-23270931 CCAGGGTTATATGTACAGAACTC 0: 1
1: 6
2: 21
3: 71
4: 255
Right 1065196496 10:23270923-23270945 ACAGAACTCTGATCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065196495 Original CRISPR GAGTTCTGTACATATAACCC TGG (reversed) Intronic
900084698 1:886366-886388 GAGTTCTGTCCATAGAACTCTGG + Intergenic
904506783 1:30963145-30963167 GGGTCCTGTACATACAACACTGG - Intronic
905680581 1:39868336-39868358 GAGTTCTTTATATATATCCTGGG - Intronic
906886345 1:49652794-49652816 GAGTTCTGTTTATAAACCCCTGG - Intronic
908450745 1:64252219-64252241 GAGTTCTGTCCATATAAGCCTGG - Intronic
908607736 1:65818504-65818526 CAGTTCTGTACATGTGACGCTGG - Intronic
909720884 1:78767851-78767873 GAGCTCTGTCCATAGAACACAGG - Intergenic
909992202 1:82237618-82237640 GAGTTCTGTAGATATCTCTCAGG + Intergenic
915659256 1:157388775-157388797 GAGTTCTGTCTATAAACCCCTGG + Intergenic
917305242 1:173617601-173617623 GAGTTATGTCTGTATAACCCTGG - Intronic
918839260 1:189513343-189513365 GAGTTCTGTCCCTATACCCTTGG - Intergenic
919111126 1:193219775-193219797 GTGTACTGTGCATATTACCCTGG + Intronic
919207746 1:194438528-194438550 GGGTTCTGTAGATATAAATCAGG - Intergenic
919220668 1:194624880-194624902 GAGTTCTGTCCCTAAACCCCTGG - Intergenic
919598952 1:199599478-199599500 CAGTTCTGTACTTGAAACCCAGG - Intergenic
921268175 1:213443467-213443489 GATTTCTGTACATTTTAGCCAGG + Intergenic
922399360 1:225236514-225236536 GAGTTCTGTAGATATCTACCAGG + Intronic
922399590 1:225238789-225238811 GAGTTCTGTCCAAATAACCCTGG + Intronic
923364739 1:233248226-233248248 GAGTTCTGTAGATAAAAGCCGGG - Intronic
924652247 1:245940106-245940128 GAGTTCTGTCCGTAAACCCCTGG - Intronic
924788818 1:247224378-247224400 GAGTTCTGTAGATATTAATCAGG - Intergenic
924952562 1:248898054-248898076 GAGTTCTGTCCATTAAACCCTGG - Intergenic
1062761816 10:28253-28275 GAGTTCTGTCCATAGAACTCTGG - Intergenic
1065145291 10:22762351-22762373 TAATTCTGCACATAAAACCCAGG + Intergenic
1065196495 10:23270909-23270931 GAGTTCTGTACATATAACCCTGG - Intronic
1065505004 10:26421370-26421392 CAATTCTGCACATATATCCCTGG - Intergenic
1066241048 10:33535216-33535238 GCGTTCTGTACATGTATCCCAGG - Intergenic
1068381134 10:56255132-56255154 GAGATCTGTCCATAAATCCCTGG + Intergenic
1071028017 10:81138931-81138953 GAGTTCTGTAGATATCTACCAGG - Intergenic
1075860819 10:125675088-125675110 GAGTTCTGTCCTTAAACCCCTGG + Intronic
1076582461 10:131520747-131520769 ATGTTCTGCACATATATCCCGGG - Intergenic
1077855080 11:6116075-6116097 GAGTTCTGTCCATAAACTCCTGG - Intergenic
1079066223 11:17296272-17296294 GAGGTCTCACCATATAACCCAGG + Intronic
1079588038 11:22150017-22150039 GAATTCTGTCCATAAACCCCTGG + Intergenic
1079637982 11:22769208-22769230 GTGTTTTGTAAATATCACCCTGG - Intronic
1079970970 11:27034457-27034479 GAGTTCTGTACATATCTACCAGG - Intergenic
1080214726 11:29827544-29827566 TAGTTCTGTCCATAAACCCCTGG - Intergenic
1081733301 11:45386345-45386367 GAGTTTTGTTCTTATCACCCAGG + Intergenic
1082746507 11:56968679-56968701 GAGTTCTGTTCATGTAACTCTGG + Intergenic
1082757476 11:57092243-57092265 GAGTTTTGTTCACGTAACCCTGG + Intergenic
1083511938 11:63217399-63217421 TAGTATTGGACATATAACCCTGG - Exonic
1084378394 11:68794434-68794456 GAGTTTTGCTCTTATAACCCAGG + Intronic
1086820718 11:91433272-91433294 GAGTTCTGTCAATATAACCCTGG + Intergenic
1087328634 11:96753267-96753289 GAGATTTGTTCATATAATCCTGG + Intergenic
1087718538 11:101636418-101636440 GAGTTCTGTCCATAAACCCCTGG - Intronic
1090185227 11:124734675-124734697 GAGCTTTGGACATAAAACCCTGG + Intergenic
1091001391 11:131912750-131912772 GATTTCTGGAAAGATAACCCTGG + Intronic
1092398140 12:8146487-8146509 GTGTTCTGTCCATAAACCCCTGG - Intronic
1092512629 12:9172976-9172998 GAGTTCTGTAGATATCAATCAGG - Intronic
1094432043 12:30380205-30380227 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1094811554 12:34143196-34143218 GAGTTATGTCCATAGAACTCTGG - Intergenic
1095575550 12:43734151-43734173 TGGTTCTGTACATATGATCCAGG + Intronic
1097300076 12:58008579-58008601 GAGTTCTGAGCCTAAAACCCAGG + Intergenic
1098047053 12:66410969-66410991 GAGTTCTATTCATAAAACCCTGG - Intronic
1098667747 12:73185171-73185193 GAGTTCTGTAGATATGAACCAGG + Intergenic
1098829982 12:75350211-75350233 GAGATCTGTCCATAAACCCCTGG - Intronic
1099442062 12:82711037-82711059 GAATTCTTTCCATACAACCCAGG + Intronic
1100115121 12:91294686-91294708 GAGTTCTGTCCTTAAACCCCTGG - Intergenic
1104247516 12:127057648-127057670 GATTTCTGTTCAAATAACCTTGG + Intergenic
1108173957 13:47773176-47773198 GAGTTCTTTCCATATAACCTTGG + Intergenic
1108511148 13:51157058-51157080 GACATCTGCACATATAACACTGG - Intergenic
1109779228 13:67085242-67085264 GAGATCTGTGAATATAGCCCTGG + Intronic
1109968781 13:69737711-69737733 GAGTTCTCTTCATAAATCCCTGG - Intronic
1110645819 13:77882629-77882651 GAGGTCTGTGCCTCTAACCCAGG - Intergenic
1110821817 13:79925897-79925919 GCGTTCTGTTCATAAACCCCTGG + Intergenic
1111348414 13:86994449-86994471 GAGTTCTGTCCATAAAACCCTGG - Intergenic
1111427544 13:88107160-88107182 GAGTTCTGTTCTTGTTACCCAGG - Intergenic
1113213120 13:108005455-108005477 CAGTACTGTTCATAAAACCCAGG + Intergenic
1116470943 14:45284920-45284942 GAGTTCTTTACATTTAAGTCTGG + Intergenic
1118375219 14:65171010-65171032 GAGTTCCTTCTATATAACCCAGG + Intergenic
1118527702 14:66664128-66664150 GAGTTCTGTAGATATATATCAGG - Intronic
1119109986 14:71962964-71962986 GAATTTTGTGCAAATAACCCAGG + Intronic
1120058508 14:79954010-79954032 GAGTTCTCTCTGTATAACCCTGG - Intergenic
1121142427 14:91555112-91555134 AAGTTCTGTCCATAAAACCCTGG - Intergenic
1122173164 14:99893691-99893713 GAGTTGTGTACAGGTATCCCTGG + Intronic
1202862843 14_GL000225v1_random:94247-94269 TATTTCTGTACTGATAACCCAGG + Intergenic
1124923465 15:34048256-34048278 GAGCTCTATCCATATAACCCTGG - Intronic
1124923519 15:34048520-34048542 GAGCTCTGTCTGTATAACCCTGG - Intronic
1126266517 15:46761047-46761069 GAGTTCTGTACATATGGGGCTGG - Intergenic
1126956257 15:53936345-53936367 GAGATCTGTTTGTATAACCCTGG - Intergenic
1127012195 15:54642836-54642858 GAGCTCTGTCTGTATAACCCTGG - Intergenic
1127695989 15:61448294-61448316 AAGTTCTGAACACATAACCATGG - Intergenic
1129566993 15:76633595-76633617 GAGTTCTGTCCATAAACACCTGG + Intronic
1130185758 15:81679893-81679915 GAGTTCTGTAGATATCTACCAGG - Intergenic
1131590909 15:93747180-93747202 AAGTTCTGTCCATGTAAGCCTGG - Intergenic
1135233261 16:20729596-20729618 GAGTTCTGTCCATTTGACCATGG + Intronic
1136643495 16:31588690-31588712 GAGTTCTGTCCCTAAACCCCTGG + Intergenic
1136662121 16:31772101-31772123 GAGTTCTGTCCCTAAACCCCTGG - Intronic
1138882309 16:61031090-61031112 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1139254338 16:65526969-65526991 AAGGTCTGTCCAGATAACCCGGG - Intergenic
1139412772 16:66778437-66778459 GAGTTTTGTACTTGTCACCCAGG + Intronic
1139618169 16:68113745-68113767 GAGTTCTGTCCATAAACTCCTGG + Intronic
1140044972 16:71434396-71434418 GTGCTCTGTTCATAGAACCCTGG - Intergenic
1140757563 16:78081787-78081809 GAGTTCTGTCCATGGAGCCCAGG - Intergenic
1140989578 16:80195998-80196020 GAGCTCTGTTCATGTAACCTTGG + Intergenic
1141213993 16:82007537-82007559 GGGATCTGTACCAATAACCCAGG + Intronic
1143180817 17:4982916-4982938 GAGTTCTGTGAACAGAACCCAGG + Intronic
1143220626 17:5258353-5258375 GATTTCTGGAAATAGAACCCAGG + Intergenic
1144120851 17:12150944-12150966 GAGCTCTGTCCATATAACCCTGG - Intergenic
1144296528 17:13880447-13880469 GAGTTCTGTAGATATCGCTCAGG - Intergenic
1146437077 17:32860119-32860141 CAGTTCTGTGCATCTCACCCAGG - Intronic
1152452844 17:80393945-80393967 GAGTACTGTACATATATTTCTGG + Exonic
1152954723 18:28583-28605 GAGTTCTGTCCATAGAACTCTGG - Intergenic
1153471364 18:5450090-5450112 GACTACTGTACATATCATCCTGG + Intronic
1153858423 18:9173974-9173996 GAGTACTGTTCATATAACCTTGG + Intronic
1156139196 18:34084337-34084359 GAGTTCTGTCCATAAACCCCTGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156694797 18:39753518-39753540 GAGTTCTGTCCCTAACACCCTGG - Intergenic
1156921289 18:42525182-42525204 GAGTCATGAACATATCACCCAGG - Intergenic
1157298292 18:46461619-46461641 GAGTTTTGTTCTTATCACCCAGG - Exonic
1157829540 18:50844385-50844407 GTGATTTGTACATATAACCAAGG - Intergenic
1158676958 18:59529139-59529161 GAGTTCTGTCCGTAAACCCCTGG + Intronic
1158765591 18:60446989-60447011 TAGCTCTGTTCATATAACCCTGG + Intergenic
1158915126 18:62117423-62117445 GAGATCTATACATATAAACATGG + Intronic
1162431698 19:10632696-10632718 GAGTTCTGTTCTTGTCACCCAGG + Intronic
1163075432 19:14886798-14886820 GAGTTTTGTTCTTATTACCCAGG - Intergenic
1164166444 19:22680653-22680675 GAGTTCTCCACATATCTCCCAGG - Intergenic
1167878420 19:52433677-52433699 CATTTCTATACAGATAACCCTGG + Intronic
927238408 2:20899206-20899228 GAGTTTTGTTCCTATCACCCAGG + Intergenic
927273039 2:21234135-21234157 GTGTTCTCTACATATAAAGCTGG + Intergenic
928883382 2:36122385-36122407 GAGTTCTGTCTGTATAACCCTGG + Intergenic
928883431 2:36122647-36122669 GAGTTCTTTCCATATATCCCTGG + Intergenic
929699378 2:44148805-44148827 GAGTTATGTGACTATAACCCTGG - Intergenic
930455730 2:51605587-51605609 GAGTTCTGTCCCTAAATCCCTGG + Intergenic
931077566 2:58733717-58733739 GAGTGCTTTTCATATATCCCAGG + Intergenic
931560438 2:63555314-63555336 GAGTTCTGCCCATAAACCCCTGG - Intronic
932661039 2:73652277-73652299 GATTTCTGGACATCTAACCAAGG - Intergenic
933465187 2:82642183-82642205 GAATTCTGTCCATGTAACCCTGG - Intergenic
933468178 2:82683178-82683200 GAGTTGTCTACTTGTAACCCAGG - Intergenic
934548699 2:95240971-95240993 GAGCTCTGTTCGTATAACCCTGG - Intronic
935881617 2:107571215-107571237 GAGATCTGTACCAAGAACCCTGG + Intergenic
936750401 2:115634886-115634908 GAGTTCTGTTGCTAAAACCCTGG + Intronic
936957418 2:118036806-118036828 GAGTTCTGTAGATATATATCAGG + Intergenic
938199155 2:129358716-129358738 GAGATCTACACATATGACCCAGG - Intergenic
939022934 2:136980417-136980439 GAGTTCTGTCCATAAAGCCCTGG + Intronic
939364968 2:141219420-141219442 GAGTTTTATCCATAAAACCCTGG - Intronic
939398382 2:141660647-141660669 GAGTTCTGTCCATAAAACTCTGG - Intronic
940057112 2:149525292-149525314 GAGCTGTGTGCATATAACCCTGG + Intergenic
942924343 2:181413772-181413794 GAGTTCTGTAGATATCTACCAGG - Intergenic
945024318 2:205605918-205605940 GAGTTCTGTCCCTAAAATCCTGG + Intronic
945384945 2:209186550-209186572 CATTTCTGTACATATCTCCCTGG - Intergenic
945524029 2:210866193-210866215 GAGTTCTGTCCATAAACCTCTGG - Intergenic
946648742 2:221868608-221868630 GAGTACTGTCCCTATAACCTTGG - Intergenic
947929378 2:233950898-233950920 CAGTTCTGAACATATAAACAGGG + Intronic
1170011486 20:11728463-11728485 GAGTTCTGTCTGTATACCCCTGG - Intergenic
1170897768 20:20431384-20431406 GAGATCTGTACAGAAAGCCCTGG + Intronic
1171500723 20:25591062-25591084 AAGTTCTGAACACATAACCATGG - Intergenic
1171774781 20:29355154-29355176 GAGTTCTGTCCATATAACTCTGG - Intergenic
1171901554 20:30863193-30863215 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1172734547 20:37116270-37116292 GAGTTTTGTTCTTGTAACCCAGG - Intronic
1173149648 20:40555385-40555407 GAGTTCTGTAGATATATATCAGG - Intergenic
1173776706 20:45714506-45714528 GAATTCTGTCCATATAAGCCTGG - Intergenic
1173864491 20:46305606-46305628 GATTTCTGTTTATATAACACGGG - Intronic
1174953318 20:55067109-55067131 GAGTTCTGTCCCTAAACCCCTGG + Intergenic
1175591919 20:60200269-60200291 AAGTTCTGTCCATAAACCCCTGG + Intergenic
1176074758 20:63243401-63243423 GAGTTCTGTCCATAGGAACCAGG + Intronic
1176227509 20:64009953-64009975 GAGTCCTGTTGATATGACCCTGG + Intronic
1176522966 21:7838551-7838573 GAGTATTTTCCATATAACCCTGG - Intergenic
1176987643 21:15456041-15456063 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1177388423 21:20435920-20435942 GAGTTCTGTACATATCTATCAGG - Intergenic
1178359517 21:31936528-31936550 GAAATCTGGACAAATAACCCAGG + Intronic
1178656986 21:34468563-34468585 GAGTATTTTCCATATAACCCTGG - Intergenic
1180320259 22:11313392-11313414 GAGTTCTGTCCATAGAACTTCGG - Intergenic
1180334924 22:11569141-11569163 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1184411290 22:44327839-44327861 GAGTTCTGGACATCTGAGCCAGG - Intergenic
950409870 3:12828905-12828927 GTGGTCTGTACATACAACACTGG - Intronic
950889559 3:16391343-16391365 GTATTCTATACATGTAACCCAGG - Intronic
951432843 3:22628183-22628205 GAGTTCTGTCCCTAAACCCCTGG + Intergenic
952694605 3:36250424-36250446 GAGTTATGTCCATAAACCCCTGG - Intergenic
954847535 3:53572872-53572894 GAGTTCTGTTCATATAAAGATGG - Intronic
956082576 3:65574310-65574332 GGGTACTGTACTTATTACCCAGG - Intronic
956157898 3:66317781-66317803 GAGTTCTGTCCATAAACCCCTGG + Intronic
956386468 3:68725015-68725037 GAGTTCTGTCCCTAGAACCCTGG + Intergenic
956861541 3:73328941-73328963 GAATTCTGTTCCTAAAACCCAGG + Intergenic
957690148 3:83556272-83556294 GAGTTCTGTCCGTAAAATCCTGG + Intergenic
959472262 3:106766708-106766730 GAGTTTTGTTCATGTAGCCCAGG + Intergenic
959883512 3:111473558-111473580 GAGTTCTGTGCCTAAACCCCTGG + Intronic
960502221 3:118452053-118452075 GAGTTCTGTAGATATCTCTCAGG + Intergenic
960680132 3:120238954-120238976 GAGTTCTGTCCATAAAACCCTGG + Intronic
961543237 3:127614824-127614846 GAGTTCTGTTGACATGACCCTGG + Intronic
962428689 3:135298938-135298960 GACCTCTGTTCATATCACCCTGG + Intergenic
962981743 3:140497291-140497313 GAGTTTTATTCATATAACCGTGG + Intronic
964034140 3:152175477-152175499 TAGTTCTACACAAATAACCCTGG - Intergenic
964183359 3:153913718-153913740 GAGCTCTCTCCATAAAACCCTGG - Intergenic
964295142 3:155225343-155225365 GAGTTCTGTCCCTAAAACTCGGG + Intergenic
964377416 3:156062947-156062969 ATGTTCTGTACATGTATCCCAGG - Intronic
965958563 3:174401442-174401464 GAGTTCTGTAGATATATATCAGG - Intergenic
966071608 3:175885415-175885437 GAGTTCTGTCCATAAGCCCCTGG + Intergenic
966342825 3:178944505-178944527 TAGGTCTGTCCATATATCCCTGG - Intergenic
966938823 3:184732227-184732249 GAGTTCTTTACCTAGAAACCTGG + Intergenic
967295238 3:187957862-187957884 GAGTCCTGTACATTTGTCCCAGG - Intergenic
967716310 3:192765922-192765944 GGGTTCTGTGCATATAAAACTGG + Intronic
968358999 3:198133556-198133578 GAGTTCTGTCCATAGAACTCTGG + Intergenic
968437198 4:599898-599920 GAGCTCTATCCATAGAACCCTGG + Intergenic
970053099 4:11938714-11938736 CAGTCCTGTCCCTATAACCCTGG - Intergenic
970185409 4:13446460-13446482 CAGTTTTGTACTTAAAACCCGGG + Intronic
971286007 4:25290781-25290803 GAGTTTTGTCCATAAACCCCTGG + Intergenic
973284801 4:48403373-48403395 GAGTTCTGTTCGTATAACCCTGG + Intronic
973545116 4:51973416-51973438 GAGTTCTGTCCGTAAACCCCTGG + Intergenic
974340040 4:60603512-60603534 GAGTTCTGTCCATATAATCCTGG + Intergenic
974899707 4:67982135-67982157 GAGTTCTGTACATATAAACCTGG + Intergenic
975998287 4:80341158-80341180 GAGTTCTGTCTGTATAACCCTGG - Intronic
976816841 4:89158538-89158560 GAATTCTGTCCATAGACCCCTGG - Intergenic
977039816 4:92002136-92002158 GAGTTCTGTCCATAAATCCCTGG - Intergenic
977524309 4:98125839-98125861 GAGTCCTGTCCATAAACCCCTGG + Intronic
977678620 4:99774381-99774403 GAGTTCTGTCCATAAACCCCTGG - Intergenic
977895158 4:102355982-102356004 CAGTTCTGTACCTATCACACAGG - Intronic
978327923 4:107579677-107579699 GAGTTCTGTCTATAAACCCCTGG - Intergenic
979576121 4:122294082-122294104 GAGTTCTGTATGTATAACTCTGG - Intronic
980645319 4:135635937-135635959 GAGCTCTGTTCCTATAACTCTGG + Intergenic
981607176 4:146552255-146552277 GAGACCTGTACACATTACCCTGG + Intergenic
981790924 4:148535797-148535819 GAGCTCTATCCATAGAACCCTGG + Intergenic
982316847 4:154040776-154040798 GAGTACTGTAATTCTAACCCAGG + Intergenic
983820941 4:172192989-172193011 GAGTTCTATCCATAAACCCCTGG - Intronic
984525600 4:180855897-180855919 ACGTTCTGTACATGTATCCCAGG - Intergenic
984845053 4:184101750-184101772 AAGTGCTGAACATATCACCCTGG - Intronic
985306491 4:188547478-188547500 AAGGTCTTTACATATAACCATGG + Intergenic
985652603 5:1113843-1113865 GGCTTCTGTACATTCAACCCTGG + Intergenic
986011887 5:3724399-3724421 GAGTTCTGTCCCTAAAACCCGGG + Intergenic
986641983 5:9880942-9880964 GAGTTCTGTCCCTAAACCCCTGG - Intergenic
986753587 5:10812489-10812511 GAGTTCTGTCCATATAACCCTGG - Intergenic
986915417 5:12613590-12613612 GAGTTCTGTTTATAAAACCGTGG + Intergenic
987103950 5:14618322-14618344 GAGTTTTGTTCTTGTAACCCAGG - Intergenic
987837167 5:23176817-23176839 GAGTTCTGTAGATATCTCTCAGG + Intergenic
987919788 5:24264620-24264642 GAGATCTGTTGCTATAACCCTGG - Intergenic
988110504 5:26813194-26813216 GAGTTCTGTCCATAAACCCCTGG - Intergenic
988670304 5:33374264-33374286 GAGTGCTGTACATATTATGCTGG - Intergenic
989276784 5:39598872-39598894 GAGTTCTGTCCATAAACCCCTGG + Intergenic
989682602 5:44046743-44046765 GAGTTCTGTCCACAAAACCCTGG + Intergenic
991227785 5:64292798-64292820 GAGTTCTGTCCATATAATCCCGG + Intronic
992571710 5:78065635-78065657 GAGTTCTGTCCCTAAACCCCTGG - Intronic
993318109 5:86436842-86436864 GAGATCTCTACATATGACACTGG - Intergenic
993365283 5:87027947-87027969 GAGTTCTGTAGATATCTCTCAGG + Intergenic
993375916 5:87149429-87149451 GAGTTCTGTTTGTATAACTCTGG + Intergenic
994222682 5:97214371-97214393 GAGTTCTGTAGATATATATCAGG - Intergenic
994298824 5:98121850-98121872 GAGTTCTGTCCATAAACCCCTGG - Intergenic
995295848 5:110520890-110520912 GAGTTTTGCACTTATTACCCAGG - Intronic
995329482 5:110931313-110931335 GAGTTCTGTAGATATATATCAGG + Intergenic
996004572 5:118405167-118405189 GAGTTCTGTCTATAAACCCCTGG + Intergenic
996036293 5:118762559-118762581 GAGTTCTGTCCATAAAACCCTGG - Intergenic
996054618 5:118969135-118969157 GAGATCTGTTCATATAACTCAGG - Intronic
996482203 5:123988271-123988293 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1000719895 5:164693412-164693434 GAGTTCTGTTCATAAACCCCTGG - Intergenic
1000749332 5:165074686-165074708 GAGTTCTGTTCATAAAACTCTGG + Intergenic
1003508148 6:6756937-6756959 GAGTTTTGTTCTTATAGCCCAGG + Intergenic
1003902402 6:10667333-10667355 GAGTTCTGTAGTTATCTCCCAGG + Intergenic
1005427918 6:25723294-25723316 GAGTTTTGTTCTTATCACCCAGG - Intergenic
1005948367 6:30612234-30612256 GAGTTGAATATATATAACCCTGG + Intronic
1006240835 6:32677315-32677337 GAGTTCTGTAGATATCTCTCAGG + Intergenic
1010233963 6:73559506-73559528 GGGTTCTGTCCATGTTACCCAGG + Intergenic
1011214170 6:84987422-84987444 GAGTTCTTTCCATATAACACTGG - Intergenic
1011377628 6:86706796-86706818 GAGTTCTGTCCCTAAACCCCTGG + Intergenic
1012142656 6:95643017-95643039 GAGCTCTGTTCATATAACCCTGG - Intergenic
1013425625 6:110010117-110010139 GAGCTCTGTTAATAAAACCCAGG + Intergenic
1014293402 6:119587896-119587918 CACCTCTGTACATAGAACCCAGG - Intergenic
1015659877 6:135563729-135563751 GAGTTCTGTAGATATCTCTCAGG + Intergenic
1016708268 6:147139209-147139231 TAGTTCTGTACATAAAACTAGGG - Intergenic
1016790733 6:148064673-148064695 GAGTTCTGTCCATAAAACCCTGG + Intergenic
1020678263 7:11205385-11205407 GATTCCTGTAGACATAACCCTGG - Intergenic
1020868003 7:13590808-13590830 GAGTTCTGTTCCTAAAACCCTGG + Intergenic
1023196159 7:37641887-37641909 GAGTTCTGTCTGTATAAACCTGG + Intergenic
1023666457 7:42527711-42527733 GAGCTTTGTCCATAGAACCCTGG - Intergenic
1025041714 7:55651465-55651487 GAGTTCTGTCCCTAAACCCCTGG - Intergenic
1026138767 7:67686632-67686654 GAGTTTTGTTCTTTTAACCCAGG - Intergenic
1028027679 7:85866900-85866922 GAGTTCTGTCCATAAACCCATGG - Intergenic
1028378289 7:90170922-90170944 AGGTTTGGTACATATAACCCAGG + Intronic
1031250366 7:119372542-119372564 GAGTTCTGTATATATCAATCTGG - Intergenic
1031335606 7:120527314-120527336 AAGTTATAAACATATAACCCTGG - Intronic
1032577227 7:133068180-133068202 GAGTTCTATACATTTAATTCAGG - Intronic
1033791532 7:144796951-144796973 GAGTTCTGTTCACATATCCATGG - Intronic
1034312255 7:150099223-150099245 AAGTTCAGTACATAAAACCATGG - Intergenic
1034794597 7:154001435-154001457 AAGTTCAGTACATAAAACCATGG + Intronic
1038515561 8:28184612-28184634 GAGTTCCTTACATCTAACACAGG - Intronic
1038917207 8:32037596-32037618 GAGTTCTGTTCATAAACCCCTGG + Intronic
1041474564 8:58249158-58249180 GAGTTCTGTCCATAAGCCCCCGG - Intergenic
1041836595 8:62223470-62223492 CAGTTTTGTACTTAAAACCCAGG - Intergenic
1043092590 8:75924349-75924371 GAGTTCTGTCCATAAACCCCTGG - Intergenic
1043363163 8:79499506-79499528 GAGGTCTATCCATAGAACCCTGG + Intergenic
1044117206 8:88350181-88350203 GAGTTCTGTTCATATAAGCCTGG + Intergenic
1044447565 8:92296812-92296834 GAGGTCTCTACATATAACCCTGG + Intergenic
1045732952 8:105263282-105263304 GAGTTCTGTCCATATAACCCTGG + Intronic
1046971673 8:120230071-120230093 GAGGTCTTTCCATATTACCCAGG + Intronic
1046986834 8:120397688-120397710 GAGTCCTGTTCATATAACCCTGG - Intronic
1046986882 8:120397962-120397984 GAGATCTGTCTGTATAACCCTGG - Intronic
1047605374 8:126468962-126468984 GAGTTCTGTACAGAGAACCAGGG + Intergenic
1047718408 8:127616859-127616881 GAGTTCTGTATATATCACCTAGG - Intergenic
1048755992 8:137738764-137738786 ATGTTCTGCACATATATCCCAGG - Intergenic
1049882397 8:145075298-145075320 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1050395213 9:5188365-5188387 GAGTTCTGTCCATGAACCCCTGG + Intergenic
1050862892 9:10458927-10458949 ATGTTCTGCACATATACCCCAGG - Intronic
1051459080 9:17293444-17293466 GAGTTCTGTCCCTAAACCCCTGG + Intronic
1051917992 9:22230414-22230436 GAGTTCAGTTCATATAACCCTGG - Intergenic
1051946385 9:22574106-22574128 GAGTTCTGTAGATATCAACCAGG - Intergenic
1053039377 9:34856930-34856952 GAGTTCTGTACATATAGCCCTGG + Intergenic
1053678735 9:40464940-40464962 GAGTTCTGTCCATAAACCTCTGG - Intergenic
1053928720 9:43093293-43093315 GAGTTCTGTCCATAAACCTCTGG - Intergenic
1054284988 9:63160002-63160024 GAGTTCTGTCCATAAACCTCTGG + Intergenic
1054291813 9:63300478-63300500 GAGTTCTGTCCATAAACCTCTGG - Intergenic
1054389831 9:64605021-64605043 GAGTTCTGTCCATAAACCTCTGG - Intergenic
1054505883 9:65911355-65911377 GAGTTCTGTCCATAAACCTCTGG + Intergenic
1055343317 9:75308643-75308665 GAGTTCTGTCCATATAACCCTGG + Intergenic
1055343545 9:75310551-75310573 GAGTTCTGTCCATATAAACCTGG + Intergenic
1056002001 9:82227601-82227623 GAGCTCTGTCCATAGAACACAGG + Intergenic
1059004202 9:110383775-110383797 GAGGTCTGTTCATAAACCCCTGG + Intronic
1060177344 9:121506663-121506685 GAGTTCTGTACAGAGAAGGCTGG + Intergenic
1060340158 9:122768105-122768127 GACTTCTGTCCATAAAACCCTGG - Intergenic
1062073069 9:134568997-134569019 GAGTTCTGTTCTTAGAACTCTGG + Intergenic
1062461512 9:136664390-136664412 GAGGTCTCTCCATGTAACCCAGG - Intronic
1062743131 9:138192689-138192711 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1062743380 9:138194690-138194712 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1062743629 9:138196691-138196713 GAGTTCTGTCCATAGAACTCTGG + Intergenic
1203368479 Un_KI270442v1:279146-279168 GAGTTCTGTCCATAGAACTCCGG - Intergenic
1186964409 X:14772276-14772298 AAGTTCTGTCTATAGAACCCTGG + Intergenic
1187897002 X:23991325-23991347 GAGTTTTGTTCTTATTACCCAGG - Intronic
1188547346 X:31323197-31323219 CAGTTGTGTACATATAACTGCGG + Intronic
1188744825 X:33829450-33829472 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1188860650 X:35251608-35251630 GAGTTCTGTCCATAAATCCCTGG - Intergenic
1189652290 X:43203482-43203504 GAACTCTGTCCATAGAACCCTGG + Intergenic
1190971816 X:55356965-55356987 GAGTTCTGTCCATAAACCCCTGG - Intergenic
1190972055 X:55359112-55359134 GAGTTCTGTAGATATCAATCAGG - Intergenic
1190992526 X:55566675-55566697 GAGTTCTGTCCATAAACTCCTGG - Intergenic
1191065512 X:56343269-56343291 GAGTTCTGTTCATATAACCCGGG + Intergenic
1191093885 X:56654719-56654741 GAGCTCTGTACATAGAACCATGG + Intergenic
1191701623 X:64048154-64048176 GAGTTCTTTCCATATAACCCTGG - Intergenic
1191815587 X:65241223-65241245 AAGTTCTGTTTGTATAACCCTGG + Intergenic
1191815639 X:65241483-65241505 GAGTTCTGTTTGTATAATCCTGG + Intergenic
1192006873 X:67223684-67223706 AGGTTCTGCACATATATCCCAGG + Intergenic
1192944365 X:75949657-75949679 GAGTTCTGTCCACAAACCCCTGG + Intergenic
1193200915 X:78689576-78689598 GAGTACTGTACTTATTACCTGGG - Intergenic
1193528347 X:82621228-82621250 GAGTTCTGTAGATATCACTCAGG - Intergenic
1193533620 X:82686496-82686518 GAGTTCTGTACTGAAATCCCTGG + Intergenic
1193647632 X:84088795-84088817 GAGTTCTGTCCCAATAACCTTGG + Intronic
1193780554 X:85696684-85696706 GAGTTCTGTAGATGTATACCAGG + Intergenic
1194007865 X:88519481-88519503 GAGTTCTGTAGATATCAATCAGG + Intergenic
1194263980 X:91733474-91733496 GAGTTCTGTTTGTAAAACCCTGG + Intergenic
1194405718 X:93493931-93493953 GAGTTCTGTCCATAAACCCTTGG - Intergenic
1194444946 X:93975842-93975864 GAGTTCTGTTCATAAACCCCAGG + Intergenic
1194813244 X:98412384-98412406 GAGTTTTATACAGATGACCCAGG - Intergenic
1196309222 X:114142265-114142287 ATGTTCTGTACATATAACGAGGG - Intergenic
1196393592 X:115234859-115234881 GAATTCTGAAGATTTAACCCTGG + Intergenic
1196550896 X:117023564-117023586 GAGTTCTGTCCTTATTACCTGGG - Intergenic
1197107774 X:122736165-122736187 CAGATCTGCACATGTAACCCTGG + Intergenic
1197424023 X:126273018-126273040 GAGTTCTGTCCATAAACCCCAGG + Intergenic
1197455236 X:126670768-126670790 GAGTTCTGTCCATATAGGCATGG - Intergenic
1197522684 X:127519690-127519712 GAGTTCTGTCCCTATAACCCTGG - Intergenic
1200321739 X:155196751-155196773 GAGTTCTGTCCATAAACCCCTGG + Intergenic
1200336510 X:155356350-155356372 GAGTTCTGTAGATATCCACCAGG - Intergenic
1200349960 X:155484877-155484899 GAGTTCTGTAGATATCCACCAGG + Intergenic
1200372213 X:155739281-155739303 GAGTTATGTCCATATAACCCTGG - Intergenic
1200731981 Y:6752574-6752596 GAGTTCTGTCCATAAATCCCTGG + Intergenic
1200837207 Y:7744150-7744172 GTATTCTGTACAAATAACCCAGG - Intergenic
1200917588 Y:8584929-8584951 GATTTCTGTACATAAAAAGCAGG + Intergenic
1201756711 Y:17494251-17494273 GAGTTCTGTCCATAGAACTCTGG - Intergenic
1201844842 Y:18411733-18411755 GAGTTCTGTCCATAGAACTCTGG + Intergenic