ID: 1065197245

View in Genome Browser
Species Human (GRCh38)
Location 10:23278497-23278519
Sequence GCCACCATGTTAGGTTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065197235_1065197245 30 Left 1065197235 10:23278444-23278466 CCCTTCCATCATTTACTCATAAC 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG No data
1065197236_1065197245 29 Left 1065197236 10:23278445-23278467 CCTTCCATCATTTACTCATAACA 0: 1
1: 1
2: 1
3: 20
4: 236
Right 1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG No data
1065197237_1065197245 25 Left 1065197237 10:23278449-23278471 CCATCATTTACTCATAACAAATA 0: 1
1: 0
2: 0
3: 27
4: 341
Right 1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG No data
1065197241_1065197245 -6 Left 1065197241 10:23278480-23278502 CCATCTACTCCATGAGGGCCACC 0: 1
1: 0
2: 1
3: 10
4: 156
Right 1065197245 10:23278497-23278519 GCCACCATGTTAGGTTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065197245 Original CRISPR GCCACCATGTTAGGTTTTAC GGG Intronic
No off target data available for this crispr