ID: 1065198517

View in Genome Browser
Species Human (GRCh38)
Location 10:23290332-23290354
Sequence AGAATGAGACTATACTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065198514_1065198517 -1 Left 1065198514 10:23290310-23290332 CCTTGCTATGCCACAGCAGAAGA 0: 1
1: 0
2: 1
3: 28
4: 307
Right 1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG No data
1065198513_1065198517 13 Left 1065198513 10:23290296-23290318 CCAAAACTAAAAAGCCTTGCTAT 0: 1
1: 0
2: 1
3: 17
4: 209
Right 1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG No data
1065198512_1065198517 14 Left 1065198512 10:23290295-23290317 CCCAAAACTAAAAAGCCTTGCTA 0: 1
1: 0
2: 4
3: 32
4: 351
Right 1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065198517 Original CRISPR AGAATGAGACTATACTGGCA TGG Intronic
No off target data available for this crispr