ID: 1065198759

View in Genome Browser
Species Human (GRCh38)
Location 10:23293475-23293497
Sequence CAGTGTGGGCAGATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 2, 2: 2, 3: 50, 4: 514}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065198759_1065198763 2 Left 1065198759 10:23293475-23293497 CCTTCTGCCATCTGCCCACACTG 0: 1
1: 2
2: 2
3: 50
4: 514
Right 1065198763 10:23293500-23293522 AGTTTGTGTTTGCTTAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065198759 Original CRISPR CAGTGTGGGCAGATGGCAGA AGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900669396 1:3841288-3841310 AAGGGTGGGGAGATGCCAGAGGG - Intronic
900774903 1:4575612-4575634 CAGTGTTGGCCTAAGGCAGAGGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
901163126 1:7195605-7195627 CAGTGCGGGCACCTGGCTGAAGG - Intronic
901771845 1:11534567-11534589 CTGGGTGGGCAGGAGGCAGAGGG + Intronic
902723248 1:18318318-18318340 CATTGTTGGCAATTGGCAGAAGG + Intronic
902891115 1:19444339-19444361 CAGGGTGGGGAGGTGGCAGCTGG - Intronic
903451533 1:23456826-23456848 GAGTCTGGGGAGATGGCAGAGGG + Intronic
904903572 1:33877103-33877125 ATGTGTGGGCAGAAGGCAAATGG + Intronic
905235331 1:36542514-36542536 CCCTGAGGGCAGATGGGAGATGG - Intergenic
906065407 1:42977009-42977031 CACTGGGGCCAGATTGCAGAGGG + Intergenic
906296814 1:44653774-44653796 CTTTGTGGGGAGATGCCAGAGGG - Exonic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
908005234 1:59720894-59720916 CAGTTTGGGCAAGTGGCAGAAGG - Intronic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911201144 1:95044651-95044673 CTGTGGGGGCAGATTGCACAGGG - Intronic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
912011020 1:104963238-104963260 CAGTTGGGGCAGATGGCATGGGG - Intergenic
912720475 1:112015793-112015815 GAGTGAGGGTAGATGGGAGAAGG - Intergenic
912943923 1:114069065-114069087 CAGTTTGTGCAGAAGACAGATGG - Intergenic
914675931 1:149907568-149907590 CCCTGTGGGAAGGTGGCAGAGGG - Intronic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915907547 1:159889895-159889917 CAGTGTTGGCTCATGGCACATGG + Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916245285 1:162681652-162681674 CTGTGTTGTCACATGGCAGAAGG + Intronic
917784703 1:178441935-178441957 CAGTCATGGCAGAAGGCAGAAGG + Intronic
919924768 1:202186553-202186575 CAGTGTGGGCATGGGCCAGACGG + Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
921594929 1:217044336-217044358 GAGTGTGTACAGATGGCAGGAGG - Intronic
921670371 1:217918061-217918083 CAGTGTGGACAGATGACACAAGG - Intergenic
922227632 1:223659371-223659393 CAGTGGGGCCAGATCACAGAGGG - Intronic
922596403 1:226816941-226816963 CAGTGTGGGGAGTTGGCTCAAGG - Intergenic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923273736 1:232379381-232379403 CAGCCTGGGCAGCTGGGAGATGG - Intergenic
923541413 1:234890934-234890956 CAGCCTGGGCAGATGTCAGCAGG - Intergenic
924309024 1:242720810-242720832 CAGTCCTGGCAGAAGGCAGAAGG - Intergenic
1063345037 10:5303752-5303774 CTGTGTTGTCACATGGCAGAAGG - Intergenic
1063517157 10:6707841-6707863 CAGTATGTGCAAATGACAGATGG - Intergenic
1064073023 10:12246858-12246880 CAGAGTGGGGAGATGACAGAGGG - Intronic
1064179529 10:13102165-13102187 CATTTCGGGCAGAGGGCAGAAGG + Intronic
1064561339 10:16597898-16597920 CTGTGTGGGCAGATGAGAGCTGG + Intronic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065768078 10:29050629-29050651 AAGTGTGGGAGGATGGGAGAGGG - Intergenic
1066223145 10:33355700-33355722 AAATGTGGGGAGATGGCTGAGGG - Intergenic
1066758003 10:38730078-38730100 CAGTGTGGGGAAGTGGCCGAGGG + Intergenic
1067045627 10:42983671-42983693 CAGGAAGGGCAGATGGCACAGGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069150863 10:64957929-64957951 CAGTGTGGACACATCTCAGAGGG + Intergenic
1069678376 10:70266052-70266074 GAGTGCGGGCAGTTGGCAGCAGG - Intronic
1070257436 10:74824898-74824920 CGGTGCAGGCGGATGGCAGAGGG - Intergenic
1070340409 10:75493403-75493425 CAGAGTGGGAAAATGGCATATGG + Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070712299 10:78691568-78691590 TAGAGTGGGTAGATGGAAGATGG + Intergenic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1074673783 10:115825600-115825622 CAGTGTGGACAGATCTCAAAGGG - Intronic
1074761777 10:116672004-116672026 CAGTGTTGGCAGATAGGTGATGG - Exonic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074825158 10:117209402-117209424 CAAGGAGGGGAGATGGCAGAAGG + Intronic
1074833664 10:117268367-117268389 CACTGAGGACAGATGGTAGAAGG + Intronic
1075102394 10:119515672-119515694 CTGTGTGTGCAGATAGCACAAGG - Intronic
1075397871 10:122141032-122141054 CAGAGAGGGCAGATTCCAGAAGG + Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1076133317 10:128028537-128028559 CAATGTGGACAGGTTGCAGAAGG + Intronic
1076238413 10:128883616-128883638 CAGTGAGGCCAGCTGGCAGCGGG - Intergenic
1076273185 10:129174543-129174565 TGGAGTGGGCAGATGGCAGCAGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076573595 10:131449232-131449254 CACTGCGGGGAGGTGGCAGAGGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1076833324 10:133007682-133007704 CAGTCTGGGAACAAGGCAGAGGG + Intergenic
1077130932 11:972190-972212 CAGCGTGGGCAGCCGGGAGATGG + Exonic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077522366 11:3043829-3043851 TACTGTGGGCAGGTGGGAGATGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1077936666 11:6795254-6795276 CTGTGTGTGCAGATGGCTGCTGG - Exonic
1078544686 11:12238780-12238802 CACTGTGGGCAGCTGGGTGAAGG + Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079019324 11:16896225-16896247 CAGTTTAGGAAGATGGCAAAGGG - Intronic
1079043159 11:17077542-17077564 GAGTGTGGGCAGCGGGCCGAGGG - Intronic
1079748517 11:24164079-24164101 GAGTGGGGCCAGATTGCAGAGGG - Intergenic
1080003994 11:27385333-27385355 TAGGGTGGGCAGATTGCTGAGGG + Exonic
1080459600 11:32441723-32441745 TAGTGTGGGCAGAAAGCAAAAGG - Intergenic
1081521442 11:43885692-43885714 CAGTGTCTGCACATAGCAGATGG - Intronic
1083089949 11:60189525-60189547 TAGTGTTGGGAGATGGCAGCTGG - Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083617257 11:64032445-64032467 CAGAGAGGGTAGATGGCAGCTGG + Intronic
1084424296 11:69076351-69076373 CAGTGTGGGCAGGTGGCCTTTGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085099420 11:73788041-73788063 CAGAGAGGGGAGATGGCGGAGGG + Intronic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1088511578 11:110580895-110580917 CTGGGTGTGCACATGGCAGATGG + Exonic
1088799964 11:113296667-113296689 CAGTGTGGGCAGATGGGGAGGGG + Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1089340956 11:117757050-117757072 CAGGGTGGGGAGTTGGCAGGAGG + Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1090254422 11:125273362-125273384 GAGGATGGGCAGATGGGAGAAGG + Intronic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093262061 12:16950612-16950634 GAGAGTGGGGAGATGGGAGAAGG - Intergenic
1093480848 12:19602390-19602412 CAGTGTCCTCATATGGCAGAGGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094045661 12:26163536-26163558 CTGTGTCGTCACATGGCAGAAGG + Intronic
1096105744 12:48996320-48996342 CAGAGTGATCAGATGACAGAGGG - Exonic
1096123525 12:49103855-49103877 CAGTGTGGGAACATTGGAGATGG + Intronic
1096514324 12:52147858-52147880 CAGTTTGGACAGATGGCACATGG - Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097250503 12:57630070-57630092 TGGAGTGGGCAAATGGCAGAGGG - Intronic
1097300009 12:58007950-58007972 GTGAGTGGGCAGATGGCAGGCGG + Intergenic
1098029196 12:66236876-66236898 CAGAGTGGGCAGGTGGCTGGAGG - Intronic
1101560694 12:105855087-105855109 CAGTATGGCCAAATGCCAGAAGG - Intergenic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1101909457 12:108850632-108850654 CAGGGAGGGGAGATGGGAGAGGG + Intronic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102462199 12:113106874-113106896 CAGTGTGGGGATATGGCTGTGGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1102661085 12:114529170-114529192 TAGTGTGGGCAGCTGGCATTTGG - Intergenic
1102805719 12:115778449-115778471 CATTATGGGGAGATGGCAGAAGG + Intergenic
1104793163 12:131496754-131496776 CAGTCAGGGAAGATTGCAGAAGG - Intergenic
1104964749 12:132503895-132503917 CAGTGGGGGCAGGAGGCTGAGGG - Intronic
1105230783 13:18493768-18493790 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1106477225 13:30109039-30109061 CGGTGGCGGCAGTTGGCAGAGGG - Intergenic
1107230540 13:38104477-38104499 CAGTGTGGGCTGCTGTCAGCAGG - Intergenic
1107253340 13:38392408-38392430 CAGCGTGGGCAGATGGGAACAGG - Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1112167707 13:96937223-96937245 AACTGTGGGCAGCTGGTAGAAGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114417590 14:22554750-22554772 CAGTTAGGGCAGAGGTCAGAGGG + Intergenic
1115451890 14:33557376-33557398 CATTGTGGGTAGAAGACAGAGGG - Intronic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119406504 14:74402651-74402673 GGGGGTGGGCAGATGGCAGAGGG - Intergenic
1120156400 14:81098135-81098157 CAGTGTGGGCAGGGAGCACATGG - Intronic
1120194448 14:81466929-81466951 GAGCTTGGGCAGAGGGCAGAGGG + Intergenic
1121019816 14:90573069-90573091 CTTTGTGAGAAGATGGCAGAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122941796 14:104984815-104984837 GGGTGAGGGCAGATGGCAGAAGG + Intergenic
1123126366 14:105948961-105948983 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123406874 15:20024994-20025016 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123516205 15:21031650-21031672 CACTGTGGGGAGAAGGCCGATGG + Intergenic
1123937103 15:25199315-25199337 CAGGGTGGGCACCTGGCTGATGG - Intergenic
1124120414 15:26883695-26883717 TGGTGTGGGCAGATGGCAACGGG - Intronic
1124176144 15:27425965-27425987 CATTGTAGCCAGATGGGAGAGGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1125239552 15:37558342-37558364 CAGTGGGGGCAGGCTGCAGATGG - Intergenic
1126175958 15:45735874-45735896 CAGGGTGGTCAGATGCCAGCAGG + Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1128090348 15:64914971-64914993 CAGCGTGGGCAGGTGGAAGCTGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1131666058 15:94572260-94572282 CAGTGGAGGCAGGTGGCACAGGG - Intergenic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132774056 16:1582040-1582062 CTGTGTGGGCAGGCGGCTGAGGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133183744 16:4079955-4079977 CTGTTTTGGCAGATGGCAAAGGG - Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133312801 16:4861139-4861161 CAGTTTGGGCAGATTGCTGTTGG + Intronic
1133496631 16:6324465-6324487 CAGTTATGGCAGAAGGCAGAAGG + Intronic
1134188261 16:12100851-12100873 CAGGGAGGGCAGCTGGCAGGTGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134459730 16:14420843-14420865 CAGTGAGGGGAGCTGTCAGAGGG - Intergenic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1136229340 16:28877650-28877672 CAGAATGTGCTGATGGCAGAGGG - Intergenic
1136719810 16:32310754-32310776 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1136724859 16:32349155-32349177 CAGTGTGGGGAAGTGGCCGAGGG - Intergenic
1136777530 16:32879736-32879758 CAGTCAGGGAGGATGGCAGACGG + Intergenic
1136838185 16:33517034-33517056 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1136843183 16:33555195-33555217 CAGTGTGGGGAAGTGGCCGAGGG - Intergenic
1136893093 16:33981778-33981800 CAGTCAGGGAGGATGGCAGACGG - Intergenic
1137002625 16:35243101-35243123 CTGTGTCTGCACATGGCAGAAGG - Intergenic
1137540067 16:49355975-49355997 CAGTGGAGGCAGATGACACATGG + Intergenic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1138233335 16:55357498-55357520 GAGAGTTGGCAGAAGGCAGAAGG + Intergenic
1138366351 16:56480970-56480992 GAGTGTGGGCAGGGGCCAGATGG + Intronic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1139624932 16:68179901-68179923 CAGTATGGGAACATGGCAGTAGG + Intronic
1140092944 16:71852145-71852167 CTTTGGGAGCAGATGGCAGAGGG + Exonic
1141015645 16:80446749-80446771 GATAGTGGCCAGATGGCAGAGGG - Intergenic
1141173863 16:81706741-81706763 CAGTGGGGGCACACGACAGAGGG + Intronic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142401515 16:89861057-89861079 CAGTGTGGGGTTAGGGCAGACGG + Intronic
1142406108 16:89891159-89891181 CAGCCTGGGCAGATGCCAGGAGG - Intronic
1203001572 16_KI270728v1_random:168600-168622 CAGTGTGGGGAAGTGGCGGAGGG + Intergenic
1203006621 16_KI270728v1_random:207015-207037 CAGTGTGGGGAAGTGGCTGAGGG + Intergenic
1203079944 16_KI270728v1_random:1141845-1141867 CAGTCAGGGAGGATGGCAGACGG + Intergenic
1203148355 16_KI270728v1_random:1817314-1817336 CAGTGTGGGGAAGTGGCTGAGGG - Intergenic
1203153348 16_KI270728v1_random:1855493-1855515 CAGTGTGGGGAAGTGGCCGAGGG - Intergenic
1142525256 17:535751-535773 TAATGTTTGCAGATGGCAGATGG - Intronic
1142819146 17:2450445-2450467 GAGTGTGGACAGACTGCAGAGGG + Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1143326022 17:6098955-6098977 CAGTGTTGGCAGGTGGCTGAGGG + Intronic
1144643478 17:16952598-16952620 GAGTGAGGGCAGCTGGCAGGCGG + Intronic
1144839329 17:18175936-18175958 CAGTGAGGGCAGAGGGCCCAGGG - Intronic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145783307 17:27577941-27577963 GAATGTGGGAAGCTGGCAGAGGG - Intronic
1146894851 17:36534103-36534125 CACTGTGGGCAGAAAGGAGACGG + Exonic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147140689 17:38459026-38459048 AAGTGTGGGAAGAAGACAGAAGG + Intronic
1147188600 17:38726062-38726084 CAGCTCGGGCAGATGGCAGAAGG + Exonic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149362779 17:55911633-55911655 GAGTGTGGGAAGGAGGCAGACGG - Intergenic
1149754040 17:59172897-59172919 GAGTGTGGGCACATGGCGCAGGG + Intronic
1149852964 17:60052146-60052168 TAGTGTTGGCTGCTGGCAGAAGG - Intronic
1150613911 17:66754413-66754435 CACAGTGGGGAGGTGGCAGATGG - Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151733403 17:75923978-75924000 CAGGGTGGGCAGATCGCTTAAGG + Intronic
1152086779 17:78224764-78224786 CTGTCTGGGCAGATGGCTGTTGG - Exonic
1152193682 17:78903653-78903675 CTGTGTGGGCAGGTGGTTGACGG - Intronic
1152210496 17:79000670-79000692 CAGTGTGGTCAGGGGACAGAAGG - Intronic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1153820643 18:8828664-8828686 CTCTCTGGGCAGATGGCAGAGGG + Intronic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154522618 18:15246089-15246111 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
1155373797 18:25134518-25134540 CAGTTTGGGCAGGTAGTAGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155911030 18:31504548-31504570 CACGATGGGCAGACGGCAGAGGG + Intronic
1156011655 18:32503601-32503623 CAGTAGGAGCAGATGCCAGATGG - Intergenic
1156124244 18:33883610-33883632 CAATGTGGGCAGATTGGAGATGG + Intronic
1156455678 18:37292385-37292407 AAGTGGGGGCAGATGTGAGATGG + Intronic
1157504972 18:48219682-48219704 CAAGGTGGGCAGGTGGCAGGAGG + Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161978487 19:7618907-7618929 CTGTGTGGGCAGGAGGCAGCTGG - Intergenic
1163029500 19:14534999-14535021 CAGTGTGGACTGCTGGGAGAGGG + Intronic
1163260838 19:16188917-16188939 TGGTGTGGTCAGATGGCAGCTGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1165324097 19:35104206-35104228 CAGAGTGGGCAGATGAGTGAAGG + Intergenic
1165423722 19:35734351-35734373 CAGTGAGAGCAGGTGGCACAGGG + Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1166258898 19:41624686-41624708 CACGGTGGGCAGATCGCAGCTGG - Intronic
1166343499 19:42151766-42151788 TGGTGGGGGCAGATGGTAGAAGG + Intronic
1167144014 19:47671575-47671597 CTGTGTGGGTATTTGGCAGAAGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1168149084 19:54435482-54435504 CAGTGTGTGCCGATGGGGGAGGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925662785 2:6220601-6220623 GAGCCTGGGCAGATGGGAGAAGG + Intergenic
925740697 2:7003776-7003798 CAGAGTGGCCACATGGCAGGTGG - Intronic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
925831548 2:7900803-7900825 CAGTGTGGGGAGGAAGCAGATGG + Intergenic
926065105 2:9832400-9832422 AAGTGAGGGTAGATGGCAGGTGG - Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927829406 2:26336126-26336148 CAGTGTGGGGAGCTGGAAGTAGG + Intronic
927875039 2:26649715-26649737 CAGTCAGGGCAGCTGGGAGAGGG - Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929806716 2:45152882-45152904 CATTGTGGGGAGGGGGCAGAAGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932127419 2:69156615-69156637 CAGTCATGGCTGATGGCAGAGGG + Intronic
932332933 2:70908893-70908915 CAGTGTGGGGACAGGGCAAAGGG - Intronic
933273619 2:80260290-80260312 CAGTGAAGAAAGATGGCAGAGGG + Intronic
933824615 2:86147761-86147783 CAGTGTGGGCAGCTGCCTGTCGG + Exonic
934321318 2:91974519-91974541 CAGTGTGGGAAAGTGGCCGAGGG + Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
936079132 2:109420363-109420385 CAGGGTGGGTAGACGTCAGAGGG + Intronic
936084269 2:109455889-109455911 CAGTGTGTGCAGGTGACAGCAGG - Intronic
936581023 2:113700675-113700697 CAATGTGGGCATATGGTAAATGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937216290 2:120315659-120315681 CAGCGTGTGCAGATGACAGCCGG - Intergenic
937674709 2:124577604-124577626 GAATGTGGGCAGAAGGGAGATGG + Intronic
937782263 2:125852591-125852613 CTGTGTGTGCAGGTGGCAGCAGG - Intergenic
938207628 2:129437715-129437737 CAGTGTGGCCAGCTGCCAGCCGG + Intergenic
938521904 2:132078942-132078964 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
940205347 2:151195946-151195968 CAGTGTAGGCAGGAAGCAGAGGG - Intergenic
943569471 2:189556195-189556217 CAGTGAGGAAAGTTGGCAGAAGG - Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
945469532 2:210211643-210211665 CAGTCATGGCAGAAGGCAGAGGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946965362 2:225031441-225031463 CAATGTGGGCACAGGGCCGAAGG + Intronic
947473231 2:230416285-230416307 TAGGGTGGGAAGATGGCAGGTGG + Exonic
947915776 2:233830843-233830865 CAGTGTGGGCTGAAGACAGAGGG - Intronic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1170122353 20:12924861-12924883 CACAGTGAGCAAATGGCAGATGG - Intergenic
1171374543 20:24683388-24683410 CGGTGGGGGCAGATGGGGGAGGG + Intergenic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1173155803 20:40607624-40607646 CAGTCTGGGAACATGGTAGAAGG - Intergenic
1174157272 20:48523805-48523827 CAGTGGGGGCAGAAGAGAGAAGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174321371 20:49744242-49744264 GAATGTTGGCAGATGGCACAGGG - Intergenic
1175443008 20:59003951-59003973 CAGTGAGGGCAGTCGGCAGTGGG + Intronic
1175631519 20:60542104-60542126 CAATGTGGGCAGAAGGCTTAAGG - Intergenic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175730718 20:61352130-61352152 TAGTGAGGGCAGAGTGCAGACGG - Intronic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175993198 20:62799745-62799767 CAGTGTGGGCTCATGGCACTGGG - Exonic
1176774775 21:13122121-13122143 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1177567720 21:22845748-22845770 CTCTGTGGGCACATGGCACATGG + Intergenic
1177745483 21:25207891-25207913 CAGTCAGGGCAGAAGGCAAAGGG - Intergenic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178449815 21:32687385-32687407 CAGTAAGGGCAGATGGCAAAGGG + Intronic
1179165167 21:38929816-38929838 CAAGGTGGGCCCATGGCAGAAGG - Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1180195981 21:46194599-46194621 CTGTCCCGGCAGATGGCAGACGG - Exonic
1180309563 22:11158488-11158510 CAGTGTGGGGAAGTGGCCGAGGG + Intergenic
1180548040 22:16520298-16520320 CAGTGTGGGGAAGTGGCCGAGGG + Intergenic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181007445 22:20020776-20020798 CAGGGTGAGCAGGTGACAGATGG + Intronic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181327030 22:22057753-22057775 CAGTGATGGCAGAATGCAGAAGG - Intergenic
1181408252 22:22700449-22700471 CAGTGTGTGCAGATGTCAATGGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1182211415 22:28680064-28680086 CAGTGTGGGGAAATGGCCGAGGG - Intergenic
1182265845 22:29114536-29114558 CTGTGTCCGCACATGGCAGAGGG - Intronic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182541420 22:31044744-31044766 AAGTGTGTGAAAATGGCAGATGG + Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184854448 22:47138811-47138833 CCGTGTGAGGACATGGCAGAGGG - Intronic
1185325111 22:50221719-50221741 CAGTGGGGGCTGGTGGCAGGGGG - Exonic
949329423 3:2905415-2905437 CTGTGTTTGCACATGGCAGAAGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949946402 3:9193323-9193345 CACTGTGGGCAGAGGGCTAAGGG - Intronic
950030255 3:9847319-9847341 CACTGTGGTCACATGGCGGAAGG - Intronic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950507296 3:13403343-13403365 CACTGTTGTCACATGGCAGAAGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950934441 3:16824338-16824360 GAGGGTGGGGAGACGGCAGATGG - Intronic
951033456 3:17907444-17907466 CAGTGTGGGCAGATCACAGGGGG + Intronic
952265137 3:31778071-31778093 CAGTATGGGCAGATGGGGAAGGG + Intronic
953415210 3:42711841-42711863 CAGTGAGGGCAGCTGCCTGAGGG - Intronic
953461202 3:43082497-43082519 CAGTGTGTGTATATGGGAGAGGG - Intronic
953551356 3:43906334-43906356 TACTGTGTGCAGGTGGCAGAGGG + Intergenic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
954834160 3:53450450-53450472 CATTGTGGGCAGGTGTCATAGGG + Intergenic
955037329 3:55281918-55281940 AAGTTTGGGCAGATGGAAGGAGG - Intergenic
955963974 3:64369096-64369118 CATTGTTGGCACAGGGCAGAGGG - Intronic
956314167 3:67915386-67915408 CAGTGTGGACGGATGGGACAGGG + Intergenic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961442676 3:126962134-126962156 CAGTCTGGTCAGATTGCAGTTGG + Intergenic
962339038 3:134565931-134565953 CACTGTGGGTTGATGGCATAAGG + Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
963633835 3:147768267-147768289 CAGTGATGGCAGAAGGCAAAGGG - Intergenic
964774714 3:160263141-160263163 TAGTGTGGGCAGCTGATAGATGG - Intronic
965582022 3:170278789-170278811 CAGTCTTGGCAGAAGGCAAAGGG + Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968624742 4:1622055-1622077 CTGTGTCGTCAGGTGGCAGAGGG - Intronic
968651657 4:1762543-1762565 GAGTCAGGGCAGAGGGCAGAAGG + Intergenic
968986809 4:3880125-3880147 CAGCCTGGGCAGAGGCCAGAGGG - Intergenic
969846365 4:9923174-9923196 CACTCTGGGCAGGAGGCAGAAGG + Intronic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
971163911 4:24162428-24162450 CACTGTGGGAATATGGCTGAGGG - Intergenic
975594533 4:76036726-76036748 CATTATAGGCAGATGGCAGGGGG + Intronic
975779345 4:77822043-77822065 GAGAGTGGGCAGATGTCAAATGG - Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976686772 4:87822614-87822636 CAGAGAGGCCAGATGACAGATGG + Intronic
977303774 4:95298366-95298388 CAGTGTGTGCAGTTGGCATAGGG - Intronic
978894973 4:113875660-113875682 CAGAGTGGGCTGATTGCAGTTGG + Intergenic
982595856 4:157382015-157382037 CAGTGTGGGCAGAGGCCCTAAGG - Intergenic
984845699 4:184106425-184106447 AAGTGTGGGGAGCTGGGAGAGGG - Intronic
984922579 4:184778573-184778595 AAGTGTGGGCGCAGGGCAGAAGG - Intronic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985625067 5:981607-981629 CAGAGTGGGAAGAAGGCAGCTGG + Intergenic
985661159 5:1157260-1157282 CAGTGTGGGCAGGTGTGAGCAGG - Intergenic
985661171 5:1157339-1157361 AGGTGTGGGCAGGTGGCACAGGG - Intergenic
985661189 5:1157449-1157471 CAGTGTGGGCAGGTGGGAACAGG - Intergenic
985661203 5:1157528-1157550 CAGCGTGGGCAGGTGGCACAGGG - Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
986189585 5:5482681-5482703 TAGTGTGGGCTGAGGGCAAAGGG + Intronic
986215490 5:5715553-5715575 CAGGGTGGGGAAATGACAGAGGG + Intergenic
987101193 5:14592601-14592623 CAGTGTGGACATATTGCTGAGGG + Intronic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
987621539 5:20342640-20342662 GAGTGTGGGATAATGGCAGAAGG + Intronic
987797006 5:22640978-22641000 AAGTGGGGGAAGTTGGCAGAAGG - Intronic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
988542326 5:32121859-32121881 CAGTCTTGGGAGCTGGCAGATGG - Intergenic
988889410 5:35598768-35598790 CAGTGTGGGCAGATGGGGATGGG + Intergenic
990312739 5:54555186-54555208 CAGGGTGGGAAGATGGGACAGGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991568158 5:68026551-68026573 CAGGGTGGGGAGAAGCCAGAGGG + Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992222209 5:74584258-74584280 CTCAGTGGGCAGATGGCAGTGGG - Intergenic
992429040 5:76689840-76689862 CAGTATAAGCAGATGACAGAGGG + Intronic
992679672 5:79141452-79141474 CAGGGTGGGCAGATCACATAAGG - Intronic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
994399118 5:99256938-99256960 CAGTGTGGGCAGATGGGGAGGGG - Intergenic
994516242 5:100775759-100775781 CATTGTGGGTAGAGGCCAGAGGG + Intergenic
996103490 5:119470299-119470321 CATGGTGGGATGATGGCAGATGG + Intronic
996595410 5:125196476-125196498 CAGAGTGGGCAGATAACACATGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
998220636 5:140275780-140275802 CAGTTTGTGTAGATGGCAGGAGG - Intronic
998328880 5:141305914-141305936 GAGCGTGGGCAGATCGCTGAGGG - Intergenic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
999521728 5:152357856-152357878 TGGTGTGTGCAGATGGCAGATGG - Intergenic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1002160370 5:177311230-177311252 GAGAGTGGGGAGATGGCAGGAGG + Intronic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002549198 5:179974460-179974482 TACTGTGGACAGATGGCAGTTGG - Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1002688134 5:181031574-181031596 AAGGGTGGGCAGATAGGAGAGGG + Intergenic
1003667111 6:8121682-8121704 CAGTGTGGGCAGCAGGCACATGG - Intergenic
1005689256 6:28286317-28286339 CAAAGTTGGCAGTTGGCAGATGG - Intronic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1005992195 6:30910264-30910286 AAGGGTGGAAAGATGGCAGAGGG + Intronic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006745593 6:36339674-36339696 CTGGGAGGGAAGATGGCAGAGGG + Intergenic
1007380159 6:41485017-41485039 CGGAGTGGGCAGATGGCCCAGGG + Intergenic
1007408640 6:41648987-41649009 CTCTATGGGCAGCTGGCAGAGGG - Intronic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012795009 6:103748733-103748755 CAGTGGGGGCAGCTTTCAGAGGG - Intergenic
1012900952 6:105005654-105005676 CAGTCATGGCAGATGGCAAAGGG - Intronic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018352256 6:162972044-162972066 GAGGATGGTCAGATGGCAGAGGG + Intronic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019179928 6:170180090-170180112 CAGGCTGGGAAGCTGGCAGAGGG + Intergenic
1019351057 7:554130-554152 ATGTGGGGGCAGATGGCGGAGGG + Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019861806 7:3665932-3665954 AATTGTGGGAAGATGGTAGAAGG - Intronic
1021183302 7:17533606-17533628 CAGAGTGGGAGGATGGGAGAAGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1021956358 7:25828828-25828850 TAGTGTGGGGAGATGGAAAATGG + Intergenic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022524657 7:31029200-31029222 CAGTGTGGGCATCTGTCTGAAGG - Intergenic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024390699 7:48808574-48808596 CTGTGTGGGCACATGGCTGCTGG + Intergenic
1024550741 7:50560832-50560854 CAGTGTGTGCAGGTGACACAGGG - Intronic
1025637432 7:63335305-63335327 CAGTGGGTGCAGGTTGCAGAGGG + Intergenic
1025645265 7:63412794-63412816 CAGTGGGTGCAGGTTGCAGAGGG - Intergenic
1026560493 7:71444381-71444403 TAGTGTGGCCACATGGCAGGAGG - Intronic
1028030458 7:85905613-85905635 CAGTGGTGGGAGGTGGCAGAGGG - Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028850215 7:95529504-95529526 CAGTCAGGGCAGATTCCAGATGG + Intronic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1029696506 7:102217186-102217208 CAGTCTGGCCAGATTGCTGAAGG - Intronic
1031121639 7:117728980-117729002 CTTTGTGGGCAGCTGACAGAGGG + Intronic
1031234056 7:119149070-119149092 GAATGTGGGCAGATAGCAGAGGG - Intergenic
1032314058 7:130817692-130817714 AGGTGTTTGCAGATGGCAGATGG + Intergenic
1032522107 7:132553267-132553289 AAGTGTGGGGACATGGCAGGAGG + Intronic
1032849854 7:135784710-135784732 CTGCGTTGGCTGATGGCAGAAGG + Intergenic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035391600 7:158508148-158508170 CACGGTGGGCAGAAGGCAGGTGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1037415430 8:18644635-18644657 CATTGTGGGCAGTTGGGTGAGGG - Intronic
1037844724 8:22272956-22272978 CAATGTGGGCAGATGGCCTGAGG - Intergenic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039248197 8:35632705-35632727 AAGTGTGGGCACATGGGAGGTGG - Intronic
1039350549 8:36759248-36759270 CAGTGTGGGGAAATGAGAGAGGG - Intergenic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1040548818 8:48422890-48422912 CATTGTGGGCAGCTGCAAGAAGG + Intergenic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042316950 8:67435321-67435343 CAGCTCAGGCAGATGGCAGAAGG + Intronic
1042887227 8:73565344-73565366 CAGTCATGGCAGATGGCAAAGGG - Intronic
1043442103 8:80285288-80285310 CTGTCTGTGCAGATGTCAGAAGG + Intergenic
1043733648 8:83717510-83717532 CAGTGTGGGAAAATGGGGGAAGG + Intergenic
1044189454 8:89297611-89297633 CAGTGGTGGCAGAAGGCAAAGGG + Intergenic
1044286072 8:90413360-90413382 CAGCCTGTGCAGAAGGCAGATGG - Intergenic
1045696885 8:104819135-104819157 CAATCTGGGCAGATGTCAGCGGG + Intronic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048754531 8:137722308-137722330 GTGTGTGGGCAGAGGGCATATGG + Intergenic
1048798818 8:138177160-138177182 CAGAGTGGGGAGCTGGCAGGTGG - Intronic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049401334 8:142428787-142428809 CTGTGTGGGGAGATGGCTGGGGG + Intergenic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1049662882 8:143828277-143828299 CAGCTTGGGCAAATGGCTGAAGG - Intronic
1049939512 9:531777-531799 CAGTGAGGACAGACGCCAGAAGG - Intronic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1051114918 9:13683712-13683734 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1051398980 9:16659120-16659142 AGGTGTGGGTAAATGGCAGATGG + Intronic
1052637395 9:31122461-31122483 CAGTCATGGCAGATGGCAAAAGG + Intergenic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056320824 9:85433220-85433242 CAGTGGGTGCAGCTCGCAGAGGG + Intergenic
1057312474 9:93950995-93951017 CAGTGAGGGCACCTGGCCGACGG - Intergenic
1057550889 9:96050200-96050222 CAGAGTCGCCAGATGGCAGGAGG + Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1057944905 9:99317534-99317556 CAGTGTGGGTGGATTGCAGGAGG + Intergenic
1058303523 9:103407454-103407476 CAGTGGGTGCAGATGACAAAGGG + Intergenic
1058811698 9:108645777-108645799 CAGTGTGGGCTGATGGCGCAAGG + Intergenic
1059450737 9:114370257-114370279 GAGTCTGAGCAGATGGCTGAGGG - Intronic
1059727391 9:117022817-117022839 CAGAGTGGGCAGTGGGCAGTGGG + Intronic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1061049447 9:128185809-128185831 CAATGTGGTCGGGTGGCAGAAGG + Intronic
1061629544 9:131863437-131863459 CAGTGGGGGCAGATCCCAGAGGG + Intronic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1062080246 9:134619940-134619962 CACTGTGGGCCGATGGGAGAAGG + Intergenic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062466505 9:136683937-136683959 CAGTGTGGGGAGAACGCACAGGG - Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1186108336 X:6228916-6228938 CAGTTTGGTCCAATGGCAGAGGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187112033 X:16312285-16312307 CAATGTTGGGAGATGGGAGAGGG + Intergenic
1187850738 X:23589355-23589377 CAGCGTGGGCTGGTGGCTGATGG - Intergenic
1188639528 X:32482850-32482872 CAGTGTTGGAAAATGGCATAAGG - Intronic
1189394928 X:40612899-40612921 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1189532758 X:41903267-41903289 TAGTGTTGGGAGACGGCAGAAGG + Intronic
1190526020 X:51330804-51330826 CAATGGTGGCAGAAGGCAGAGGG + Intergenic
1190912716 X:54787483-54787505 CAGGATGGGGTGATGGCAGAGGG + Intronic
1190918242 X:54825907-54825929 CAGGATGGGGTGATGGCAGAGGG - Intergenic
1190923862 X:54883570-54883592 CAAGGTGGGCAGATGTCATAAGG + Intergenic
1192008925 X:67247411-67247433 TGGTGTGGGCAGATGGAAAAGGG + Intergenic
1193042748 X:77020865-77020887 CAAGGTGGGCAAATGGCAGTAGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1194421150 X:93673923-93673945 CAGGGTGGGCGGATGGGAGAAGG - Intergenic
1195512965 X:105738881-105738903 CTGTGAGGGCAGAAAGCAGAGGG + Intronic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1197445861 X:126552063-126552085 CAGGGAGGGCAGCTGGTAGATGG + Exonic
1197985961 X:132266614-132266636 CAGTGTAGTTAGATGGCAGTTGG - Intergenic
1198103434 X:133441003-133441025 GAGTGTGGGCAAATGACCGAGGG + Intergenic
1200007146 X:153094658-153094680 CAGTGAAGGTAGATGGGAGAGGG + Intergenic
1200102323 X:153694306-153694328 CAGTCAGGGAGGATGGCAGACGG - Intronic