ID: 1065199862

View in Genome Browser
Species Human (GRCh38)
Location 10:23302012-23302034
Sequence CGGCAAACAGCAGAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065199855_1065199862 13 Left 1065199855 10:23301976-23301998 CCAGAGGGATGGAAGTCAGCGGT 0: 10
1: 44
2: 108
3: 118
4: 166
Right 1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG No data
1065199853_1065199862 23 Left 1065199853 10:23301966-23301988 CCTGCTGGATCCAGAGGGATGGA 0: 14
1: 44
2: 107
3: 135
4: 303
Right 1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065199862 Original CRISPR CGGCAAACAGCAGAGGTGGA CGG Intronic
No off target data available for this crispr