ID: 1065202394

View in Genome Browser
Species Human (GRCh38)
Location 10:23325821-23325843
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065202393_1065202394 30 Left 1065202393 10:23325768-23325790 CCAAAGATGTTAAAGCAGTTATT No data
Right 1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr