ID: 1065203342

View in Genome Browser
Species Human (GRCh38)
Location 10:23334886-23334908
Sequence CTTTCAAAAAAGATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065203340_1065203342 -4 Left 1065203340 10:23334867-23334889 CCAGGGCATAGATGATGAGCTTT 0: 1
1: 0
2: 1
3: 4
4: 121
Right 1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG No data
1065203339_1065203342 0 Left 1065203339 10:23334863-23334885 CCAGCCAGGGCATAGATGATGAG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065203342 Original CRISPR CTTTCAAAAAAGATGGAAAT AGG Intronic
No off target data available for this crispr