ID: 1065203483

View in Genome Browser
Species Human (GRCh38)
Location 10:23336469-23336491
Sequence CACATCTAACACTCAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065203479_1065203483 20 Left 1065203479 10:23336426-23336448 CCAATGAGAGGGCCTAGAAGAAT 0: 1
1: 0
2: 3
3: 20
4: 184
Right 1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG No data
1065203482_1065203483 -9 Left 1065203482 10:23336455-23336477 CCAGTAGTGATGAGCACATCTAA 0: 1
1: 0
2: 4
3: 37
4: 198
Right 1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG No data
1065203481_1065203483 8 Left 1065203481 10:23336438-23336460 CCTAGAAGAATGGCACTCCAGTA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065203483 Original CRISPR CACATCTAACACTCAGATGT TGG Intronic
No off target data available for this crispr