ID: 1065204064

View in Genome Browser
Species Human (GRCh38)
Location 10:23341733-23341755
Sequence CTGGGTAGAAAGATGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065204064_1065204071 23 Left 1065204064 10:23341733-23341755 CCAGGCACCATCTTTCTACCCAG 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1065204071 10:23341779-23341801 GCTAGCCTGATAGATCCTTAGGG No data
1065204064_1065204070 22 Left 1065204064 10:23341733-23341755 CCAGGCACCATCTTTCTACCCAG 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1065204070 10:23341778-23341800 TGCTAGCCTGATAGATCCTTAGG No data
1065204064_1065204066 -7 Left 1065204064 10:23341733-23341755 CCAGGCACCATCTTTCTACCCAG 0: 1
1: 0
2: 1
3: 22
4: 189
Right 1065204066 10:23341749-23341771 TACCCAGTGTTCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065204064 Original CRISPR CTGGGTAGAAAGATGGTGCC TGG (reversed) Intronic
900767129 1:4513122-4513144 CTGGGAACAAAGCTGATGCCTGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
903500337 1:23796978-23797000 CTGGGGTTAAAGCTGGTGCCTGG - Intronic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904208591 1:28871193-28871215 CTTGGTACCAAGATGGAGCCTGG - Intergenic
905616304 1:39402567-39402589 CTGGCTAGAAAGATAGCACCAGG + Intronic
906075599 1:43049649-43049671 CTGGGGAGAAGGGAGGTGCCAGG + Intergenic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
907998151 1:59653778-59653800 CTGGCTTAAAAGATGGTGGCAGG - Intronic
919958777 1:202444969-202444991 CTGGGTGGGAAGGTGGTGCTGGG + Intronic
920006369 1:202836469-202836491 ATGGGGTGAAAGAGGGTGCCAGG - Intergenic
920010108 1:202861218-202861240 CAGGGTAGAAAAGTGGTGCCGGG + Intergenic
920439007 1:205966202-205966224 CTGGGTAGCAGCATGGTGCAGGG + Intergenic
921778584 1:219132796-219132818 CAGGGAAGAAAGAAGGTGACTGG + Intergenic
1064031069 10:11883241-11883263 CAGGGTAGAAAAAGGATGCCTGG - Intergenic
1064335395 10:14436084-14436106 ATGGGCAGAATGATGTTGCCCGG - Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1066481853 10:35803988-35804010 CTGGGTAGTAAGATTGTGACTGG - Intergenic
1067432931 10:46255847-46255869 GTGGGTAGAGAGCTGGAGCCAGG - Intergenic
1067440328 10:46305590-46305612 GTGGGTAGAGAGCTGGAGCCAGG + Intronic
1070403862 10:76077229-76077251 CTAAGTAGGAGGATGGTGCCTGG - Intronic
1071100766 10:82034902-82034924 AAGTATAGAAAGATGGTGCCAGG - Intronic
1071580967 10:86769936-86769958 CTGGCAAGAAGGCTGGTGCCTGG - Intronic
1074452222 10:113568453-113568475 ATGGGCAGAAAGATGAGGCCAGG + Intronic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1078056404 11:8012638-8012660 GTGAGTAGAGAGATGATGCCGGG - Intergenic
1078580900 11:12539026-12539048 CTGGGTAGAAAGCTAGAGGCAGG + Intergenic
1079104151 11:17559687-17559709 CAGGCCAGGAAGATGGTGCCAGG - Intronic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1081615059 11:44585938-44585960 CCAGGTTGAAAGATGGTGCAGGG + Intronic
1081779969 11:45703438-45703460 CTGGGTAGGGAGAGGATGCCTGG + Intergenic
1081967550 11:47178779-47178801 ATGGGTTGAAAATTGGTGCCAGG - Intronic
1082861193 11:57858220-57858242 CTGAGGAGAAAGATGGAGCCTGG + Intergenic
1083183484 11:61003803-61003825 CTGGATGGAAAGACGGTTCCAGG + Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1083878559 11:65537327-65537349 CAGGCTAGGCAGATGGTGCCTGG + Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085911008 11:80826606-80826628 CTGAGTTAAAAGATGGTGTCAGG - Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089325176 11:117652051-117652073 CTGAGAAGGAAGATGGTGCAAGG - Intronic
1090554987 11:127864499-127864521 CTGGTTAGAAATATGTAGCCAGG - Intergenic
1091352992 11:134912671-134912693 CAGGGTAAAAAGATGCTGGCTGG - Intergenic
1091360664 11:134976554-134976576 CTGGGTGGAGGGAGGGTGCCCGG - Intergenic
1092017985 12:5175412-5175434 CACGGGAGAAAGATGGAGCCTGG + Intergenic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1093877445 12:24366468-24366490 TTTGGTAGCAAGATGGTGGCGGG - Intergenic
1094004752 12:25737667-25737689 AAGGGTACAGAGATGGTGCCAGG - Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1095755979 12:45767693-45767715 CTGGGGAGAACGATGGTGTGTGG + Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1101423362 12:104567402-104567424 TTGGGTAGAAAGGTGTTCCCTGG + Intronic
1101878106 12:108608717-108608739 CTGGGTTGGAAGCTGGTGTCAGG - Intergenic
1102705053 12:114874086-114874108 CTCTTAAGAAAGATGGTGCCGGG + Intergenic
1103040501 12:117691331-117691353 CTGCAAAGAAAGATGGTGCCAGG + Intronic
1103393719 12:120592025-120592047 CTGGGGAGGAAGCTGCTGCCTGG + Intergenic
1106349911 13:28920666-28920688 GTGGGTCCAAAGATGCTGCCTGG + Intronic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1111731300 13:92080206-92080228 CTGTGGAGAACGATGGTGCAGGG - Intronic
1113430063 13:110242060-110242082 TTGGTTGGAAAGAGGGTGCCTGG - Intronic
1120221141 14:81735145-81735167 CTGGCGAGAAAGATAGTGGCTGG - Intergenic
1121017816 14:90558996-90559018 GTGTGAAGAAAGAAGGTGCCAGG - Intronic
1121036084 14:90704741-90704763 CTCAGAAGAAAGATGGTGTCGGG + Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122572006 14:102710469-102710491 TTGGGTAGAAAGACGGTACTTGG + Intronic
1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG + Intergenic
1125718258 15:41832033-41832055 CTGGGAAGCATGGTGGTGCCTGG - Intronic
1125911707 15:43445721-43445743 GTAGGCAGAACGATGGTGCCAGG - Intronic
1128542117 15:68543502-68543524 CAGGGTAGAAAGATGGGGATTGG - Intergenic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1133200265 16:4199990-4200012 CTCTGTAAAAAGATGGGGCCGGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1138039458 16:53647167-53647189 CTGGCCAGAAAGATGGTCTCTGG + Intronic
1138305706 16:55972574-55972596 CAGGGTTGAGAGATGGGGCCTGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140679018 16:77365681-77365703 CTGGGAAGAAAAATGGCACCTGG + Intronic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140861303 16:79020611-79020633 CTGGGTAGAAAGATGGCGATGGG + Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1143540112 17:7563567-7563589 CTGGGGTGAAAGATGGTTCTTGG - Exonic
1143661916 17:8330266-8330288 ATGAGTAGAAATATGGTACCGGG - Intergenic
1144326620 17:14188390-14188412 TTGGGAAGATAGATGGTTCCAGG + Intronic
1144347739 17:14365233-14365255 CTGGGAAGAAAAACGGTTCCAGG + Intergenic
1146477013 17:33171123-33171145 AGGGGTAGCAAGATGGTACCGGG + Intronic
1147589073 17:41669654-41669676 CTGTGTCGAATGAAGGTGCCAGG + Intergenic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148435704 17:47682837-47682859 CTGAGGAGAAAGATGGAGCCTGG + Exonic
1148810867 17:50290271-50290293 ATGTGTAGCAAGATGGTGTCTGG + Intergenic
1149999726 17:61426176-61426198 CTGGCTGGCAAGATAGTGCCGGG + Intergenic
1151682396 17:75628987-75629009 CAGGGGAGGAAGATGGAGCCGGG - Exonic
1152753351 17:82076739-82076761 CTGGGTGGGAACAAGGTGCCAGG - Intergenic
1152866479 17:82726703-82726725 CTGGGTGGGAAGCGGGTGCCTGG + Intronic
1156436692 18:37138455-37138477 CTGGGTAGAATAATGGTCTCTGG - Intronic
1157442149 18:47719408-47719430 CTGTGTGGAAAAGTGGTGCCTGG - Intergenic
1157551105 18:48582400-48582422 CTGGGGATAAAGGAGGTGCCTGG + Intronic
1157946217 18:51983761-51983783 CAGAGTAGAAAAATGGTGCCAGG + Intergenic
1160121339 18:76133047-76133069 CCGGATAGGAAGATGTTGCCTGG + Intergenic
1160488225 18:79312635-79312657 CTGTGTGGGAAGATGGTGCGGGG + Intronic
1160572694 18:79829740-79829762 CTGTGTGGAAAGCTGGTGCCGGG + Intergenic
1160929714 19:1564692-1564714 CTGGGGAGAGGGCTGGTGCCAGG + Intronic
1164393446 19:27844735-27844757 CTGGGTAGATAGCTGCTGCTAGG + Intergenic
1164770020 19:30801457-30801479 CTTGGTAGAGAGATGGCCCCTGG + Intergenic
1168115652 19:54220298-54220320 GTGGGCAGAGAGATGGTTCCAGG - Intronic
1168118639 19:54240044-54240066 GTGGGCAGAGAGATGGTTCCAGG - Intronic
1168714051 19:58516959-58516981 CTGGGAAGGAAGGAGGTGCCTGG + Exonic
925262898 2:2543329-2543351 CTCGGCAGGAAGATGGCGCCCGG + Intergenic
926319238 2:11736946-11736968 CTGGGAAGAAGGATGAAGCCTGG + Intronic
926893939 2:17663352-17663374 CTGTGTAGAAAGCTGTTGGCTGG - Intergenic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
928820217 2:35352886-35352908 CTGACTTGAAAGATAGTGCCAGG + Intergenic
929679331 2:43973998-43974020 TTGGGTAGAAAGAGGATGCGGGG - Intronic
930087146 2:47505736-47505758 CTGGGGAGAGAGATGAAGCCGGG + Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932571328 2:72940015-72940037 CTGGTGAGGAAGATGGGGCCTGG - Intergenic
935277994 2:101492275-101492297 CTGCGTAGAAACATGGAGCATGG - Intergenic
942044105 2:172089179-172089201 TTGGGTAGAAAGAGGGAGCGAGG + Exonic
948468186 2:238162094-238162116 CTGGGCAGAAACTTGGTGCTTGG + Intronic
1170170933 20:13411713-13411735 GTGGTTAGAATGCTGGTGCCTGG - Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1172121212 20:32599875-32599897 TTGGGTAGCAGGATAGTGCCAGG + Intronic
1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG + Intergenic
1174775528 20:53339884-53339906 CTGGGAAGTGAGATGCTGCCTGG - Intronic
1175257762 20:57657315-57657337 CTGGGGAGAGTGACGGTGCCTGG - Intronic
1183349618 22:37327599-37327621 CTGGGAATAAAGAAGGTTCCAGG - Intergenic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
949617668 3:5772231-5772253 GTGTGTAGAGAGAGGGTGCCAGG - Intergenic
953370138 3:42380608-42380630 CTGGTTAGAAAGCTGGTCTCCGG - Intergenic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956617337 3:71185582-71185604 CTGGGTAGACAGATAGTCCCAGG + Intronic
958924973 3:100147764-100147786 CTGGGCAGAAATAAGGTCCCAGG - Intronic
960736603 3:120787847-120787869 CTGGAAAGAAGGCTGGTGCCAGG + Intergenic
962608230 3:137050387-137050409 CTGGGTATAAAGATGTGGGCTGG - Intergenic
963944970 3:151135710-151135732 CTAGGTGGAAAGATGCTGGCAGG + Intronic
964415023 3:156438239-156438261 CTGGGAAGAAAAATGTTCCCAGG - Intronic
964978428 3:162647742-162647764 CTGGGCAGCAAAATGTTGCCTGG - Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968726650 4:2251000-2251022 CTGGGTGGAGAGGAGGTGCCTGG - Intronic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969857396 4:10011249-10011271 CTGGGTGGGATGGTGGTGCCTGG - Intronic
970213512 4:13734909-13734931 TTGGGAAAAGAGATGGTGCCTGG + Intergenic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
973638015 4:52877694-52877716 CTGGGTGGAAGGATGCAGCCGGG - Intronic
974958580 4:68673051-68673073 CTGGCTGGGAAGATGGTGGCTGG - Intergenic
977026400 4:91823612-91823634 CTTGGGAGAAAGATGGAGACTGG + Intergenic
978231115 4:106401140-106401162 CTGGGTGGTAAGTTGGAGCCAGG + Intergenic
984682364 4:182624638-182624660 CTGGGGAGAAAAATGGTGTGAGG - Intronic
984722573 4:182989522-182989544 CAGAGTAGAAAGGTGGTTCCTGG + Intergenic
986318614 5:6609364-6609386 CTGGCTAGAAAGATGCAGCCCGG - Intronic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
988918433 5:35919487-35919509 CAGGGTGGAAAGATGGTGCCGGG + Intronic
990184836 5:53201637-53201659 CTGGCTGGGAAGATGGTGACTGG - Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991594541 5:68288976-68288998 CTTGGTTGGAAGTTGGTGCCAGG + Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998179386 5:139925862-139925884 GTGGGTAGAGAGGTGGGGCCTGG - Intronic
1001236505 5:170034342-170034364 CTGGGGAGAAAGACTGTGCTGGG - Intronic
1002168895 5:177364350-177364372 ATGGGAAGAAAGATGGGGGCAGG + Intronic
1002330493 5:178437355-178437377 CTGGGATGAAACAGGGTGCCAGG + Intronic
1004142050 6:13027137-13027159 GTGGGGAGAAAGAGGGTACCGGG + Intronic
1006382513 6:33708098-33708120 ATGGGAAGAAAGATGGTCCTGGG - Intronic
1006548960 6:34804501-34804523 ATGGGAAGAAAGGTGATGCCAGG + Intronic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1013481139 6:110553805-110553827 CTGTGTAGAAGGATGGGGCTGGG - Intergenic
1014833757 6:126133589-126133611 CTGGGTAGAAGGATGGATCTAGG + Intergenic
1015491171 6:133827233-133827255 AAGTGTAGAAAGATGTTGCCTGG + Intergenic
1019097193 6:169591913-169591935 CTGGGTGGAGAGCTGGTTCCAGG - Intronic
1019553590 7:1617303-1617325 TTGGGAAGGAAGATGGTGCCTGG + Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1024993416 7:55253880-55253902 CTCGGAAGAAAGATGGAGGCGGG - Intronic
1025635840 7:63318310-63318332 CTGGGTGGAAAGTGGTTGCCAGG - Intergenic
1025646856 7:63429870-63429892 CTGGGTGGAAAGTGGTTGCCAGG + Intergenic
1028003739 7:85535349-85535371 GTGGGTGGAAAGATTGAGCCTGG + Intergenic
1028887188 7:95947477-95947499 CTGGGTAGACCAATGGTGGCAGG - Intronic
1032477082 7:132219051-132219073 CTGAGATGCAAGATGGTGCCGGG + Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1034206582 7:149321339-149321361 CTGAGGAGAAAGATGGAGCCTGG - Intergenic
1034902415 7:154915639-154915661 CTGGGTGGAGAGGCGGTGCCAGG + Intergenic
1035117045 7:156533485-156533507 ATGGGTGGAAAGAGGATGCCAGG - Intergenic
1037667854 8:20986154-20986176 CTGCCTAAAAAGATGATGCCAGG + Intergenic
1037745607 8:21641837-21641859 CTGGGAAGAAAGGTGGAGGCAGG - Intergenic
1038391579 8:27206977-27206999 CAGGGGAGAAAGGTGGTGGCAGG - Intergenic
1038541183 8:28391448-28391470 CAGGCTAGAGAGATGGTGGCTGG - Intronic
1040072649 8:43201031-43201053 CCGGGTGGAAAGATGATGTCAGG - Exonic
1040816805 8:51516736-51516758 CTTGGTAGTAAAATGCTGCCAGG + Intronic
1041451031 8:58007040-58007062 CTAGGTAGCAGCATGGTGCCTGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044753207 8:95436043-95436065 CTGGGTAGAAACATGGGCCAAGG + Intergenic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1049038522 8:140095383-140095405 CTGGTTAGAAAGCTGATGACCGG + Intronic
1049551322 8:143261298-143261320 CTGGGGAGGAAGATGGGCCCTGG + Intronic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050301597 9:4264327-4264349 CTGGGGAGAGAGATGGTCGCTGG - Intronic
1050367051 9:4882274-4882296 CTGGGCAGAAAGAAGCTGCCAGG - Intronic
1050566536 9:6889888-6889910 CAGCCTAGAAAGAGGGTGCCAGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1056262704 9:84864538-84864560 CTGGGGGTAAAGGTGGTGCCTGG + Intronic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1057561364 9:96130477-96130499 CTGGGTAGGAAGACGGTACATGG + Intergenic
1057942054 9:99293798-99293820 CTGGGAGGAAAGATGGTCCCGGG - Intergenic
1058369111 9:104244231-104244253 CTGGGCATATAGATGTTGCCTGG + Intergenic
1058824066 9:108759290-108759312 CTGGGGAGCAAGGTGCTGCCTGG - Intergenic
1059415078 9:114157183-114157205 TTGGGCAGAAAAGTGGTGCCAGG + Intronic
1060113829 9:120925890-120925912 GTGGGCAGAAAGTGGGTGCCAGG - Intronic
1186843516 X:13508699-13508721 CTGGGTAGAGAAATCATGCCAGG - Intergenic
1193151930 X:78134516-78134538 CTGGGTAGACTGCTGGTTCCAGG - Intronic
1198943403 X:141983150-141983172 CTGTGTAGAAAGATTATTCCTGG + Intergenic
1200135816 X:153874056-153874078 CTGGGGAGGGAGATGGTGACAGG + Intronic