ID: 1065210317

View in Genome Browser
Species Human (GRCh38)
Location 10:23396371-23396393
Sequence CACGCATCCGAGACCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065210308_1065210317 21 Left 1065210308 10:23396327-23396349 CCTTCCTGGGGGCCCTCTTCTTA No data
Right 1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG No data
1065210309_1065210317 17 Left 1065210309 10:23396331-23396353 CCTGGGGGCCCTCTTCTTAAGAG No data
Right 1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG No data
1065210307_1065210317 27 Left 1065210307 10:23396321-23396343 CCAGCTCCTTCCTGGGGGCCCTC No data
Right 1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG No data
1065210312_1065210317 8 Left 1065210312 10:23396340-23396362 CCTCTTCTTAAGAGTAGATGGTG No data
Right 1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG No data
1065210311_1065210317 9 Left 1065210311 10:23396339-23396361 CCCTCTTCTTAAGAGTAGATGGT No data
Right 1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065210317 Original CRISPR CACGCATCCGAGACCCTGGA GGG Intergenic
No off target data available for this crispr