ID: 1065214802

View in Genome Browser
Species Human (GRCh38)
Location 10:23439251-23439273
Sequence TTCCTGCTGCGCCACAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065214802_1065214809 6 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214809 10:23439280-23439302 CGGGACCCGGGCGCTATTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1065214802_1065214814 27 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214814 10:23439301-23439323 GGCTGCTGACTCGCGGCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 109
1065214802_1065214807 -6 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214807 10:23439268-23439290 CAGGAATTTGGCCGGGACCCGGG 0: 1
1: 0
2: 0
3: 7
4: 198
1065214802_1065214806 -7 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214806 10:23439267-23439289 GCAGGAATTTGGCCGGGACCCGG 0: 1
1: 0
2: 1
3: 10
4: 171
1065214802_1065214812 20 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214812 10:23439294-23439316 TATTCGCGGCTGCTGACTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1065214802_1065214813 23 Left 1065214802 10:23439251-23439273 CCTGCGCTGTGGCGCAGCAGGAA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065214813 10:23439297-23439319 TCGCGGCTGCTGACTCGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065214802 Original CRISPR TTCCTGCTGCGCCACAGCGC AGG (reversed) Intergenic
900786882 1:4655084-4655106 TTGCTGCGCCGCGACAGCGCCGG + Exonic
901511272 1:9719143-9719165 TTCCTGCAGGACCACAGCCCAGG - Intronic
901954950 1:12777330-12777352 AACCTGCTGCGCCACACCGTCGG + Exonic
901972667 1:12920171-12920193 AACCTGCTGCGCCACACCGTCGG + Exonic
902012513 1:13281591-13281613 AACCTGCTGCGCCACACCGTCGG - Exonic
903204276 1:21768840-21768862 TTACTGCTGCACCACAGCCTGGG - Intronic
903642304 1:24868324-24868346 TTCTTTCTGCACCACAGCCCAGG - Intergenic
908796293 1:67833565-67833587 CTCCTGCGGGGCCACAACGCGGG - Intergenic
913206507 1:116543973-116543995 TTCCTGCTTCCCCACACAGCGGG - Intronic
913218297 1:116638933-116638955 TTCCAGCTGCGCCACTGCCCAGG + Intronic
915098234 1:153479246-153479268 GTCCTGCTTCTCCACAGCGCTGG - Intergenic
1063450152 10:6145451-6145473 TTCCCGCTGCGCTCCAGCCCCGG + Intronic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1065214802 10:23439251-23439273 TTCCTGCTGCGCCACAGCGCAGG - Intergenic
1070145850 10:73772793-73772815 TTCTTGCTGAGCCACGGCCCGGG + Exonic
1070627070 10:78058786-78058808 TTCCTGCTGCCCCACAGGTGGGG + Intergenic
1073176405 10:101560080-101560102 TCCCTGCAGCCCCACAGCTCTGG + Intergenic
1073239031 10:102042532-102042554 TTCCTGCTGCTCCACATGGAAGG - Intronic
1073290355 10:102410416-102410438 TTCCTGCAGCGCAGCAGCACCGG + Intronic
1075995501 10:126873402-126873424 TTCCTGTTTGGCCACAGCACTGG - Intergenic
1076272486 10:129166344-129166366 TCCCTGCTGAGCCACACCACTGG - Intergenic
1076304975 10:129459701-129459723 TTCCTGCTGGGGCACAAAGCAGG - Intergenic
1076423492 10:130351093-130351115 GTCCTGCTCAGCCACAGCCCAGG - Intergenic
1081771900 11:45655396-45655418 TTCCTGCTGAGCCACCGCAGTGG + Intronic
1087904760 11:103682766-103682788 TGCCTGTTGCCCCACAGTGCTGG + Intergenic
1089563264 11:119356632-119356654 TCCCTGCCGGGCCACAGCTCAGG + Exonic
1090207849 11:124895786-124895808 TTCCAGCTGAGCCACACCGCCGG + Exonic
1091830008 12:3542752-3542774 TTCCTGCTGAGCCACACCTTTGG + Intronic
1092923252 12:13251127-13251149 TTCCTGCTGTGTAACAGCCCAGG - Intergenic
1095942956 12:47738297-47738319 TCCCTGCTGCTGCACAGGGCAGG - Intronic
1095976214 12:47942560-47942582 CTCCTGCGGCCCCAAAGCGCGGG + Intronic
1098469068 12:70823632-70823654 TTCTTGCTGCCCCACACTGCAGG - Intronic
1104967449 12:132514610-132514632 TTCATGCTGAGCCACAGTCCCGG + Intronic
1105029576 12:132873525-132873547 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1105029594 12:132873615-132873637 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1105029612 12:132873705-132873727 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1107993813 13:45841473-45841495 TTCCAGCTGTGGCACAGCACTGG - Intronic
1113618545 13:111697635-111697657 TCCCTGCTGGGCCAGAGCACAGG + Intergenic
1113624074 13:111782896-111782918 TCCCTGCTGGGCCAGAGCACAGG + Intergenic
1119717804 14:76871073-76871095 TCGCTGCTGCGCCAAAGCGTGGG - Intergenic
1122790522 14:104182402-104182424 TTTCTGCTGGGACGCAGCGCTGG - Intergenic
1123053836 14:105560107-105560129 TCCCAGCTGCTCCACAGCCCAGG - Intergenic
1123078419 14:105680524-105680546 TCCCAGCTGCTCCACAGCCCAGG - Intergenic
1124527569 15:30471227-30471249 CTCCTGCAGCGCCACCTCGCCGG - Intergenic
1124771090 15:32536475-32536497 CTCCTGCAGCGCCACCTCGCCGG + Intergenic
1124926575 15:34075825-34075847 TTCCTTCTGTGCCAAAGAGCAGG - Intergenic
1126177069 15:45745720-45745742 TTGCTGCTGGCCCACAGGGCAGG + Intergenic
1129683567 15:77671847-77671869 CTCCTCCTACGCCACAGGGCTGG + Intronic
1132928836 16:2448108-2448130 TTCCTGCGGCCACACAGTGCCGG + Intronic
1133716840 16:8458103-8458125 TTCCTGCTGAGCTGCAGCTCTGG - Intergenic
1138404340 16:56777354-56777376 TTCCTGCTGCCCCAGAGTGGTGG - Intronic
1140455897 16:75105355-75105377 TTCCTGTGGGGCCACAGCACTGG + Intronic
1141720311 16:85751874-85751896 TTCCTCCTGCCCCACTGGGCAGG - Intergenic
1143095919 17:4478323-4478345 TTCCTCCTGGGCCCCAGCGAGGG + Intronic
1144157716 17:12523110-12523132 TTCCTGCAGGGCCCCAGAGCTGG - Intergenic
1144629638 17:16864415-16864437 TGTTTGCTGCGCCACAGCCCAGG + Intergenic
1145091883 17:19992974-19992996 TTCCAGGCGCGCCACCGCGCGGG - Intergenic
1145231751 17:21178098-21178120 TTCATGCTGGGCCACACAGCAGG + Intronic
1145286737 17:21511807-21511829 TGCCGGCTTCGCCAGAGCGCCGG - Intergenic
1145390874 17:22454534-22454556 TGCCGGCTTCGCCAGAGCGCCGG + Intergenic
1147609060 17:41790979-41791001 TTTCTGCTGCTGCAAAGCGCGGG - Intergenic
1147862892 17:43533904-43533926 TTCCTGCTGCAGGACAGGGCCGG + Exonic
1152474699 17:80510407-80510429 TTCCTGATGCGCCACCGCCACGG + Intergenic
1152689290 17:81710737-81710759 TTCCTGTTGAGCCCCAGCCCAGG + Intergenic
1153201896 18:2655713-2655735 TTCCTCCTGCGCCACAGTCCCGG + Intergenic
1156807256 18:41200307-41200329 TATCTGCTGGGCCACAGAGCTGG - Intergenic
1160240437 18:77118959-77118981 TTCCTGCTGTCCCAGGGCGCTGG + Intronic
1163819717 19:19489256-19489278 TGCCTGCAGCTCCACAGCCCTGG + Intronic
1163838522 19:19591511-19591533 TTCCTGCAGCACAACAGCCCTGG + Intronic
1164677796 19:30113388-30113410 TCCCTGCTCCTCCACACCGCAGG + Intergenic
1165243003 19:34482113-34482135 TTCCCTCTGCGGCCCAGCGCGGG - Exonic
1166316169 19:41991453-41991475 TTCCTACTGCCCTACAGTGCCGG + Intronic
1166703989 19:44898198-44898220 TTCCTGCAGCTCCAGAGAGCTGG + Intronic
1168713871 19:58516201-58516223 TGCCTGCTGCTCCACAGAGTGGG + Intronic
925855176 2:8122647-8122669 TTCCAGCTGCGTCACAGGGAGGG - Intergenic
928401267 2:30980303-30980325 TTCCTGCTGCTCCGCAGCTGTGG - Intronic
929200214 2:39227432-39227454 TGCCTGCTGCTCCACAGCTGGGG + Intronic
929460861 2:42101364-42101386 TTCCTCCTGCGGCGCCGCGCGGG - Intergenic
933049967 2:77590802-77590824 CTCCCCCTGCTCCACAGCGCTGG + Intronic
936919559 2:117673891-117673913 TTCCTTCTGCCCCACAGCCCTGG - Intergenic
937321227 2:120961981-120962003 TTCCTCCTGCCCCTCAGCCCAGG + Intronic
942598791 2:177618952-177618974 TTCCTGTGGCGCCGCTGCGCAGG + Exonic
948946732 2:241224288-241224310 TGCCTGCTTCCCCCCAGCGCCGG + Exonic
1168963015 20:1881642-1881664 TTCCTGCTGGGACACAGCCCAGG + Intergenic
1170484861 20:16806176-16806198 CTCCTGCTGCATCAAAGCGCTGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1174133279 20:48360551-48360573 TCCCTGCGGGGCCACAGCGTGGG - Intergenic
1174391158 20:50219177-50219199 TTCCTGCTGCCACACAGTGTTGG + Intergenic
1178431226 21:32520403-32520425 CCCCTGCTGAGCCACAGTGCTGG + Intergenic
1179925114 21:44529887-44529909 TTCCTGCTGGGACACAGCCTTGG + Exonic
1180819598 22:18817012-18817034 TTCCAGCTGCACCACTGCCCAGG + Intergenic
1181205825 22:21251457-21251479 TTCCAGCTGCACCACTGCCCAGG + Intergenic
1183220200 22:36507158-36507180 TGCCTGCTCCGGCCCAGCGCGGG + Intergenic
1183623329 22:38987237-38987259 GTCCTGCTGGGCCTCAGCCCTGG + Intronic
1183627631 22:39014433-39014455 GTCCTGCTGGGCCTCAGCCCTGG + Intronic
1183628930 22:39021589-39021611 GTCCTGCTGGGCCTCAGCCCTGG + Intronic
1183702591 22:39458269-39458291 TTCCTGCTGCACCCCAGCTCAGG - Intronic
1185161802 22:49234500-49234522 TTCCTCCTGCACCAGAGCACAGG + Intergenic
1203221096 22_KI270731v1_random:43956-43978 TTCCAGCTGCACCACTGCCCAGG - Intergenic
1203269729 22_KI270734v1_random:42865-42887 TTCCAGCTGCACCACTGCCCAGG + Intergenic
950496494 3:13337216-13337238 CTCGTGCTGCCCCACAGTGCTGG + Intronic
952906403 3:38141834-38141856 TTCCTCCTTCCCCACAGGGCAGG + Exonic
954187339 3:48927686-48927708 CCCCTGCTGCTCCACATCGCTGG - Exonic
956701442 3:71962727-71962749 TGCCTCCTGGGCCACAGAGCAGG - Intergenic
956859526 3:73308678-73308700 TGCCTGCAGAGCCACAGGGCAGG - Intergenic
961683338 3:128613425-128613447 TTCCTGTTCCTCCACAGTGCTGG - Intergenic
974792696 4:66712365-66712387 TTCCACCTGCGCCCCAGTGCGGG - Intergenic
975043224 4:69770007-69770029 TTCTGGCTGCACCACAGCCCTGG - Intronic
980525648 4:133988580-133988602 ATCCTGCAGAGCCACAGGGCAGG - Intergenic
985727686 5:1524427-1524449 TTCCAGCCGCGCCTCAGCCCAGG + Intergenic
989025706 5:37065058-37065080 TTTCTGCTGCACAACAGCGAAGG - Exonic
994258501 5:97629500-97629522 TTCCTGCTCCTCCAAAGGGCAGG + Intergenic
998199645 5:140108819-140108841 TTTTTACTGCCCCACAGCGCTGG + Intronic
998714510 5:144867644-144867666 TTCCTGTGGGGCCACAGCACTGG + Intergenic
1001663851 5:173416335-173416357 TTCCTGCTGCAGCCCAGCTCTGG - Intergenic
1003110669 6:3249922-3249944 TTCCTACTGAGCCACAGCCCAGG + Intronic
1003248448 6:4403625-4403647 CTCTTGCTGCTCCACAGCGTAGG + Intergenic
1019213615 6:170425270-170425292 TTCCTGCTGAGACACAGACCCGG - Intergenic
1019627685 7:2028792-2028814 TTCCGCCTGTGCCACAGTGCTGG - Intronic
1020188678 7:5977649-5977671 TTCATGCTGAGCGACAGCCCTGG - Exonic
1020294237 7:6747122-6747144 TTCATGCTGAGCGACAGCCCTGG + Intergenic
1023349741 7:39308751-39308773 TTCCTGCCGTGCCTCAGCCCTGG - Intronic
1032329106 7:130961181-130961203 TTACTGCTGAGCCAAAGCCCAGG + Intergenic
1032698777 7:134360542-134360564 TTCCTGCTTCCCCACAACCCCGG + Intergenic
1034308904 7:150070108-150070130 TTCCTGCTGCTCCAAAGCTGTGG - Intergenic
1034797946 7:154030534-154030556 TTCCTGCTGCTCCAAAGCTGTGG + Intronic
1035602186 8:903068-903090 TGCCTGCTGCGCCACAACACTGG - Intergenic
1036824667 8:11966691-11966713 TTCCCGCTGCGCCACATCAATGG - Intergenic
1037945620 8:22987783-22987805 TTGCTGCTGGGCCACAGTCCAGG - Intronic
1039888856 8:41671151-41671173 TTTCTGCTGCGGCACAGGGCGGG + Intronic
1040563882 8:48548793-48548815 TTCCTCCTGCGTTACAGCGTTGG - Intergenic
1045173756 8:99698041-99698063 CTCCTGCTGCCCCACTGCCCTGG + Intronic
1049630545 8:143652995-143653017 TGCCTGCTGTGGCACAGAGCTGG + Exonic
1050470716 9:5986596-5986618 TTCCTACTTCTCCACAGCACAGG + Intronic
1054716267 9:68560249-68560271 TACCTGCTGCTCCATAACGCTGG - Intergenic
1056592499 9:87974661-87974683 TTGCTGCTGCGTGACAGCGGAGG - Exonic
1056801562 9:89695583-89695605 TTCCTGCTGCAGGACAGCCCTGG + Intergenic
1057943255 9:99303293-99303315 TTCCTGCTCCTCCCCAGCACAGG - Intergenic
1059549867 9:115218053-115218075 TTCCAGCTCTGCCACAGTGCTGG + Intronic
1060878438 9:127100453-127100475 CTCCTCCTGCCCAACAGCGCTGG - Intronic
1060971728 9:127742168-127742190 TCCCTGCTGACCCACAGCTCTGG - Intronic
1062685602 9:137811405-137811427 TTCCTGCTGGCTCACAGTGCTGG - Intronic
1193221726 X:78934712-78934734 TTCCAGCAGCACCACAGCTCTGG - Intergenic
1201716122 Y:17045727-17045749 TTCCTGTTTCTCCACAGTGCAGG - Intergenic