ID: 1065215088

View in Genome Browser
Species Human (GRCh38)
Location 10:23440181-23440203
Sequence GATCGCTGCGACGCGCCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065215086_1065215088 0 Left 1065215086 10:23440158-23440180 CCAGGGGCTGGGAGAGGGGCGGC 0: 1
1: 1
2: 15
3: 214
4: 1354
Right 1065215088 10:23440181-23440203 GATCGCTGCGACGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 26
1065215084_1065215088 1 Left 1065215084 10:23440157-23440179 CCCAGGGGCTGGGAGAGGGGCGG 0: 1
1: 0
2: 14
3: 95
4: 755
Right 1065215088 10:23440181-23440203 GATCGCTGCGACGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 26
1065215083_1065215088 2 Left 1065215083 10:23440156-23440178 CCCCAGGGGCTGGGAGAGGGGCG 0: 1
1: 1
2: 8
3: 87
4: 720
Right 1065215088 10:23440181-23440203 GATCGCTGCGACGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065215088 Original CRISPR GATCGCTGCGACGCGCCCGG TGG Exonic
913592237 1:120341077-120341099 GTTCGCTGCCGCGAGCCCGGCGG - Intergenic
923107880 1:230868470-230868492 GATCGCGGCTTCGCGCTCGGCGG - Exonic
1065215088 10:23440181-23440203 GATCGCTGCGACGCGCCCGGTGG + Exonic
1075037299 10:119080364-119080386 GGTCCCCGCGACGCACCCGGAGG + Intronic
1076993810 11:289039-289061 GGTCGCTGGGCCGGGCCCGGGGG - Intergenic
1077060863 11:617370-617392 GGTCCCTACGATGCGCCCGGTGG - Exonic
1077254020 11:1572594-1572616 GGTCTGTGCGACGCGGCCGGGGG - Intergenic
1097109128 12:56645283-56645305 GACCGCCACGATGCGCCCGGTGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121595093 14:95156773-95156795 GGCCGCTGTGCCGCGCCCGGAGG - Intronic
1143610787 17:8016357-8016379 CATCGCTGCCTCGCGCGCGGGGG - Intronic
948468593 2:238163788-238163810 GCTCGCAGCGACCGGCCCGGCGG - Exonic
1169914675 20:10673528-10673550 CATCGCTGCGCCGCGCGCCGCGG + Exonic
1178992134 21:37365987-37366009 GGACGCTGCGCCGGGCCCGGCGG - Intronic
1185259734 22:49854459-49854481 GGTCCTTGCGACGCGCCCCGAGG + Intronic
968465513 4:748000-748022 GAGCACAGAGACGCGCCCGGAGG - Intronic
975848902 4:78551870-78551892 GCTCGCGGGGACGCGCCGGGAGG - Intronic
1021998306 7:26201538-26201560 GTTCGCGGCGTGGCGCCCGGTGG - Exonic
1035453964 7:158997184-158997206 GGAGGCTGGGACGCGCCCGGGGG - Intergenic
1052807400 9:33025254-33025276 GACGGCTGCGGCGCGCCGGGCGG + Exonic
1053620517 9:39809730-39809752 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1053626184 9:39874204-39874226 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1053878689 9:42569028-42569050 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1053893979 9:42725349-42725371 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1054217704 9:62376497-62376519 GATGGCTGCGACGCGTGCGCAGG - Intergenic
1054232999 9:62532667-62532689 GATGGCTGCGACGCGTGCGCAGG + Intergenic
1054263640 9:62897713-62897735 GATGGCTGCGACGCGTGCGCAGG + Intergenic