ID: 1065218179

View in Genome Browser
Species Human (GRCh38)
Location 10:23470903-23470925
Sequence TTTATGTTCAGCAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065218178_1065218179 5 Left 1065218178 10:23470875-23470897 CCTGAAAAAATGTGGGGGAGATG No data
Right 1065218179 10:23470903-23470925 TTTATGTTCAGCAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065218179 Original CRISPR TTTATGTTCAGCAAGTGTCC TGG Intergenic
No off target data available for this crispr