ID: 1065219215

View in Genome Browser
Species Human (GRCh38)
Location 10:23478958-23478980
Sequence TGGGATTATACGCATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065219212_1065219215 -10 Left 1065219212 10:23478945-23478967 CCTCCCAAACTGCTGGGATTATA 0: 439
1: 32670
2: 341624
3: 265755
4: 200695
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data
1065219207_1065219215 3 Left 1065219207 10:23478932-23478954 CCTCCTACCTGAGCCTCCCAAAC No data
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data
1065219206_1065219215 4 Left 1065219206 10:23478931-23478953 CCCTCCTACCTGAGCCTCCCAAA No data
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data
1065219208_1065219215 0 Left 1065219208 10:23478935-23478957 CCTACCTGAGCCTCCCAAACTGC No data
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data
1065219205_1065219215 14 Left 1065219205 10:23478921-23478943 CCTCAAGCAACCCTCCTACCTGA No data
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data
1065219210_1065219215 -4 Left 1065219210 10:23478939-23478961 CCTGAGCCTCCCAAACTGCTGGG 0: 7
1: 1949
2: 102598
3: 316888
4: 335318
Right 1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065219215 Original CRISPR TGGGATTATACGCATGAGCT TGG Intergenic
No off target data available for this crispr