ID: 1065222798

View in Genome Browser
Species Human (GRCh38)
Location 10:23513377-23513399
Sequence AGGCAAACAGCAGTAGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065222790_1065222798 24 Left 1065222790 10:23513330-23513352 CCCTGCCGGATCCGGAGTGGTGA No data
Right 1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG No data
1065222793_1065222798 13 Left 1065222793 10:23513341-23513363 CCGGAGTGGTGAAAGTCAGTGAC No data
Right 1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG No data
1065222791_1065222798 23 Left 1065222791 10:23513331-23513353 CCTGCCGGATCCGGAGTGGTGAA No data
Right 1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG No data
1065222792_1065222798 19 Left 1065222792 10:23513335-23513357 CCGGATCCGGAGTGGTGAAAGTC No data
Right 1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065222798 Original CRISPR AGGCAAACAGCAGTAGTGGA CGG Intergenic
No off target data available for this crispr