ID: 1065229514

View in Genome Browser
Species Human (GRCh38)
Location 10:23582943-23582965
Sequence TGGTACCCACTGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065229509_1065229514 3 Left 1065229509 10:23582917-23582939 CCCTTAACTGTGAGTTTACCTAA No data
Right 1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG No data
1065229510_1065229514 2 Left 1065229510 10:23582918-23582940 CCTTAACTGTGAGTTTACCTAAG No data
Right 1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065229514 Original CRISPR TGGTACCCACTGATGGAGAA AGG Intergenic
No off target data available for this crispr