ID: 1065237126

View in Genome Browser
Species Human (GRCh38)
Location 10:23664223-23664245
Sequence CTGCCCTCACAGAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065237126_1065237129 17 Left 1065237126 10:23664223-23664245 CCAAATTCCTTCTGTGAGGGCAG No data
Right 1065237129 10:23664263-23664285 AATCAGATATCAACAATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065237126 Original CRISPR CTGCCCTCACAGAAGGAATT TGG (reversed) Intergenic
No off target data available for this crispr