ID: 1065239654

View in Genome Browser
Species Human (GRCh38)
Location 10:23693638-23693660
Sequence CGCCTTCTGCGCACCTCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239654_1065239661 25 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239661 10:23693686-23693708 GGATGTCTGGGTCTCTGCTAAGG No data
1065239654_1065239658 12 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239658 10:23693673-23693695 CACTCAGCCTCAAGGATGTCTGG No data
1065239654_1065239659 13 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239659 10:23693674-23693696 ACTCAGCCTCAAGGATGTCTGGG No data
1065239654_1065239656 4 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239656 10:23693665-23693687 GAACCAGGCACTCAGCCTCAAGG No data
1065239654_1065239662 26 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239662 10:23693687-23693709 GATGTCTGGGTCTCTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239654 Original CRISPR CGCCTTCTGCGCACCTCTGC CGG (reversed) Intergenic