ID: 1065239659

View in Genome Browser
Species Human (GRCh38)
Location 10:23693674-23693696
Sequence ACTCAGCCTCAAGGATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239654_1065239659 13 Left 1065239654 10:23693638-23693660 CCGGCAGAGGTGCGCAGAAGGCG No data
Right 1065239659 10:23693674-23693696 ACTCAGCCTCAAGGATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239659 Original CRISPR ACTCAGCCTCAAGGATGTCT GGG Intergenic
No off target data available for this crispr