ID: 1065239893

View in Genome Browser
Species Human (GRCh38)
Location 10:23694831-23694853
Sequence GCGGGCGGGTAGCGTGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239893_1065239910 28 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239910 10:23694882-23694904 TTGAAAGTCGTTTCCGGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1065239893_1065239909 25 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239893_1065239908 24 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239908 10:23694878-23694900 TGAATTGAAAGTCGTTTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1065239893_1065239906 22 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239906 10:23694876-23694898 GGTGAATTGAAAGTCGTTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1065239893_1065239907 23 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239907 10:23694877-23694899 GTGAATTGAAAGTCGTTTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1065239893_1065239902 1 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239902 10:23694855-23694877 GGGGAGCCTCGAGAGCCTCCAGG 0: 1
1: 1
2: 0
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239893 Original CRISPR GCGGGCGGGTAGCGTGACAG TGG (reversed) Intronic