ID: 1065239899

View in Genome Browser
Species Human (GRCh38)
Location 10:23694846-23694868
Sequence TCTCGAGGCTCCCCCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239899_1065239913 23 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239913 10:23694892-23694914 TTTCCGGGGGAGGACGGAGAGGG 0: 1
1: 0
2: 2
3: 8
4: 200
1065239899_1065239908 9 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239908 10:23694878-23694900 TGAATTGAAAGTCGTTTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1065239899_1065239909 10 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239899_1065239910 13 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239910 10:23694882-23694904 TTGAAAGTCGTTTCCGGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1065239899_1065239906 7 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239906 10:23694876-23694898 GGTGAATTGAAAGTCGTTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1065239899_1065239911 17 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239899_1065239912 22 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239912 10:23694891-23694913 GTTTCCGGGGGAGGACGGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 194
1065239899_1065239907 8 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239907 10:23694877-23694899 GTGAATTGAAAGTCGTTTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239899 Original CRISPR TCTCGAGGCTCCCCCGCGGG CGG (reversed) Intronic
902817972 1:18926875-18926897 GCTCGAGGCTCCCGCTCAGGAGG + Intronic
905308642 1:37034956-37034978 CCTCGCGGCTCCCACGCGGCGGG + Intergenic
908978712 1:69928401-69928423 TCTGTAGGCTCCACCGCTGGGGG - Intronic
913719229 1:121574827-121574849 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
914574419 1:148952085-148952107 TGTCGAGGCTCCTCCTCGCGGGG - Intronic
915725054 1:158011516-158011538 TCTCAAGGCTGCCCTGTGGGAGG + Intronic
919783520 1:201239702-201239724 TCTGTAGGCTCCCCCTCTGGGGG - Intergenic
920401752 1:205680493-205680515 TCTCCAGGTTACTCCGCGGGGGG + Intergenic
921121743 1:212143370-212143392 TCTGGAGGCTCCGCAGCGGTGGG + Intergenic
921934703 1:220786282-220786304 GCTCGAGGCTCCCCGCCGGTAGG + Intergenic
1063332970 10:5180571-5180593 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1065239899 10:23694846-23694868 TCTCGAGGCTCCCCCGCGGGCGG - Intronic
1065863812 10:29895636-29895658 TCCCGAGGCTCCGCAGGGGGAGG + Intergenic
1076621582 10:131792454-131792476 GCTCCAGGCTGCCCCGGGGGAGG + Intergenic
1076680799 10:132170269-132170291 CCTCCAGGGTCCCCCGAGGGCGG + Intronic
1077107303 11:847820-847842 GCTCGAGGGTCCCAGGCGGGTGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1085967015 11:81539876-81539898 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1093736417 12:22625319-22625341 TCCCGGGGCGCCCTCGCGGGAGG - Exonic
1093930284 12:24949110-24949132 TCGCGAGTCTCCGCCGCGAGAGG - Intronic
1096952149 12:55484544-55484566 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
1098369067 12:69738662-69738684 GCCCGAGGTTCCTCCGCGGGCGG - Intronic
1101297084 12:103434923-103434945 TCTGCAGGCTCCACCTCGGGGGG + Intronic
1102394562 12:112575215-112575237 GCTCGAGGGTCACGCGCGGGTGG + Intronic
1103153554 12:118663490-118663512 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1103708878 12:122896142-122896164 TCACGTGTCCCCCCCGCGGGGGG - Exonic
1112159666 13:96854290-96854312 TCTCGAAGCTCACCCGGGGCAGG + Intergenic
1114736699 14:25049931-25049953 GCACGAGGCTCCTCCCCGGGGGG + Exonic
1121916563 14:97841063-97841085 TCTCCAGGCTCGTCCTCGGGAGG + Intergenic
1122182619 14:99967108-99967130 TCCCGAGGCTCCCCCTCAGTGGG - Intergenic
1202916095 14_GL000194v1_random:174028-174050 TCTGTAGGCTCCACCTCGGGGGG - Intergenic
1123464559 15:20505967-20505989 GCCCGAGGCTGCCCCGCGGGTGG + Intergenic
1123653555 15:22495074-22495096 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1123743975 15:23303934-23303956 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1124275288 15:28321934-28321956 GCCCGAGGCTGCCCCGCGGGTGG + Intronic
1124307416 15:28589667-28589689 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1126537639 15:49783961-49783983 TCTGTAGGCTCCACCGCTGGGGG - Intergenic
1128835668 15:70807356-70807378 TCTCAAGGCTGCCCCGCTGGAGG + Intergenic
1134765071 16:16750631-16750653 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1134980980 16:18608580-18608602 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
1136567243 16:31077746-31077768 TCACCAGGCTCCCCCGGTGGCGG - Exonic
1137326061 16:47438238-47438260 TCTGTAGGCTCCACCGCTGGGGG + Intronic
1137761967 16:50948325-50948347 TCTCCAGCCTCCTCCGCGGCGGG + Intergenic
1140048587 16:71459303-71459325 TCTTAAGGCTGCCCCGCTGGGGG - Intronic
1152654168 17:81512431-81512453 GGCCGAGGCTTCCCCGCGGGAGG - Exonic
1168471348 19:56643218-56643240 CTTCGAGGGACCCCCGCGGGCGG + Intronic
1202670367 1_KI270709v1_random:44360-44382 TCTGTAGGCTCCACCTCGGGGGG + Intergenic
928080763 2:28310339-28310361 TCTCCTGGCTCCCCTGGGGGAGG + Intronic
935612689 2:105042221-105042243 TCTCAAGGCTCCACTGTGGGTGG + Intronic
936840163 2:116758715-116758737 TCTCGAGGCTCCACCCCAGGGGG - Intergenic
944043134 2:195378688-195378710 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
945649211 2:212538388-212538410 ACTCGAGGCAGCCCCGCCGGCGG + Intronic
947278814 2:228425466-228425488 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
947465563 2:230341961-230341983 TCTCTAGGCTCCACCTCTGGGGG - Intronic
1176030209 20:63007988-63008010 TCTCCAGGCTCCGCCCCAGGAGG + Intergenic
1176635447 21:9188674-9188696 TCTGTAGGCTCCACCTCGGGGGG - Intergenic
1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG + Intergenic
1179829119 21:43985043-43985065 ACTGGAGGCTCCCAGGCGGGAGG + Exonic
1184649603 22:45913508-45913530 TCTCCAGGCCCCCCCAGGGGTGG - Intergenic
1185148452 22:49151544-49151566 CCTCGAGGCTGACCCCCGGGAGG - Intergenic
1185287975 22:50010879-50010901 TCTCGGGGCTTCCCAGCGGCCGG + Intronic
949919614 3:8990676-8990698 TCTCGATCCTCCCCCGGGTGAGG + Exonic
950635001 3:14308196-14308218 ACTCGAGGCTCACCAGCCGGGGG - Intergenic
954631153 3:52048252-52048274 TGTCAAGGCTCCCCTGGGGGTGG - Intergenic
963050700 3:141140919-141140941 TCTGGAGGCTCCACCTCTGGGGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
963954865 3:151242296-151242318 TCTCTAGGCTCCACCTCTGGGGG + Intronic
976529471 4:86135208-86135230 TCTGGAGGCTCCACCTCTGGGGG + Intronic
976905199 4:90228145-90228167 TCTGGAGGCTCCACCTCTGGGGG + Intronic
977485052 4:97634014-97634036 TCTCTAGGCTCCACCTCTGGGGG + Intronic
981958071 4:150503104-150503126 TCTGGAGGCTCCACCTCTGGGGG + Intronic
983799025 4:171903666-171903688 TCTGGAGGCTCCACCTCTGGGGG + Intronic
985565133 5:611882-611904 TCTGGAGGGGTCCCCGCGGGGGG + Intergenic
986429008 5:7663422-7663444 GCTCCAGGCCCCCCCGTGGGAGG - Intronic
987980938 5:25083128-25083150 TCTGTAGGCTCCCCCTCTGGGGG - Intergenic
988003920 5:25384001-25384023 TCTGTAGGCTCCCCCTCTGGGGG - Intergenic
992148744 5:73880021-73880043 TCTGTAGGCTCCACCGCTGGGGG - Intronic
992675390 5:79101352-79101374 TCTCTAGGCTCCACCTCTGGGGG - Intronic
1021373841 7:19883237-19883259 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1025619316 7:63154302-63154324 TCTCTAGGCTCCACCTCTGGGGG - Intergenic
1027270391 7:76515499-76515521 TCTCCAGCCTCCCTCGCAGGAGG - Intronic
1029168767 7:98616782-98616804 TCGCGAGCCACCCCCGCGGCAGG - Intergenic
1029225988 7:99028777-99028799 TCACGAGCCTAACCCGCGGGAGG - Exonic
1036733341 8:11284873-11284895 ACTCCATGCTCCCCCGCGGCCGG - Exonic
1038140526 8:24840103-24840125 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
1040612397 8:48998147-48998169 TCTTTAGGCTCCACCGCTGGGGG + Intergenic
1041017985 8:53610041-53610063 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
1049280278 8:141740670-141740692 ACTCTCGGCTCCCCCACGGGTGG + Intergenic
1056040476 9:82660455-82660477 TCTCAAGGCTCCACTGGGGGAGG + Intergenic
1188085421 X:25896515-25896537 TCTCGAGGAATCCCTGCGGGGGG - Intergenic
1192136198 X:68602797-68602819 TCTCTAGGCTCCACCTCTGGGGG + Intergenic
1197984105 X:132249616-132249638 TCTGTAGGCTCCACCGCTGGGGG - Intergenic