ID: 1065239899

View in Genome Browser
Species Human (GRCh38)
Location 10:23694846-23694868
Sequence TCTCGAGGCTCCCCCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239899_1065239909 10 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239899_1065239911 17 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239899_1065239908 9 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239908 10:23694878-23694900 TGAATTGAAAGTCGTTTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1065239899_1065239913 23 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239913 10:23694892-23694914 TTTCCGGGGGAGGACGGAGAGGG 0: 1
1: 0
2: 2
3: 8
4: 200
1065239899_1065239912 22 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239912 10:23694891-23694913 GTTTCCGGGGGAGGACGGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 194
1065239899_1065239906 7 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239906 10:23694876-23694898 GGTGAATTGAAAGTCGTTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1065239899_1065239910 13 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239910 10:23694882-23694904 TTGAAAGTCGTTTCCGGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1065239899_1065239907 8 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239907 10:23694877-23694899 GTGAATTGAAAGTCGTTTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239899 Original CRISPR TCTCGAGGCTCCCCCGCGGG CGG (reversed) Intronic