ID: 1065239909

View in Genome Browser
Species Human (GRCh38)
Location 10:23694879-23694901
Sequence GAATTGAAAGTCGTTTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239892_1065239909 26 Left 1065239892 10:23694830-23694852 CCCACTGTCACGCTACCCGCCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239901_1065239909 6 Left 1065239901 10:23694850-23694872 CCGCGGGGGAGCCTCGAGAGCCT 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239903_1065239909 -5 Left 1065239903 10:23694861-23694883 CCTCGAGAGCCTCCAGGTGAATT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239900_1065239909 7 Left 1065239900 10:23694849-23694871 CCCGCGGGGGAGCCTCGAGAGCC 0: 1
1: 0
2: 8
3: 6
4: 148
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239893_1065239909 25 Left 1065239893 10:23694831-23694853 CCACTGTCACGCTACCCGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239899_1065239909 10 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1065239898_1065239909 11 Left 1065239898 10:23694845-23694867 CCCGCCCGCGGGGGAGCCTCGAG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1065239909 10:23694879-23694901 GAATTGAAAGTCGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239909 Original CRISPR GAATTGAAAGTCGTTTCCGG GGG Intronic