ID: 1065239911

View in Genome Browser
Species Human (GRCh38)
Location 10:23694886-23694908
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239899_1065239911 17 Left 1065239899 10:23694846-23694868 CCGCCCGCGGGGGAGCCTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239904_1065239911 -7 Left 1065239904 10:23694870-23694892 CCTCCAGGTGAATTGAAAGTCGT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239898_1065239911 18 Left 1065239898 10:23694845-23694867 CCCGCCCGCGGGGGAGCCTCGAG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239903_1065239911 2 Left 1065239903 10:23694861-23694883 CCTCGAGAGCCTCCAGGTGAATT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239900_1065239911 14 Left 1065239900 10:23694849-23694871 CCCGCGGGGGAGCCTCGAGAGCC 0: 1
1: 0
2: 8
3: 6
4: 148
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239901_1065239911 13 Left 1065239901 10:23694850-23694872 CCGCGGGGGAGCCTCGAGAGCCT 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79
1065239905_1065239911 -10 Left 1065239905 10:23694873-23694895 CCAGGTGAATTGAAAGTCGTTTC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1065239911 10:23694886-23694908 AAGTCGTTTCCGGGGGAGGACGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type