ID: 1065239915

View in Genome Browser
Species Human (GRCh38)
Location 10:23694906-23694928
Sequence CGGAGAGGGTGCTGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239904_1065239915 13 Left 1065239904 10:23694870-23694892 CCTCCAGGTGAATTGAAAGTCGT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 226
1065239903_1065239915 22 Left 1065239903 10:23694861-23694883 CCTCGAGAGCCTCCAGGTGAATT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 226
1065239905_1065239915 10 Left 1065239905 10:23694873-23694895 CCAGGTGAATTGAAAGTCGTTTC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239915 Original CRISPR CGGAGAGGGTGCTGCAGTCC TGG Intronic
900150302 1:1175853-1175875 TGGAGAGGCTGCTGCCGTGCAGG + Intronic
900394953 1:2449594-2449616 GGCAGAGGCTGCTGCAGACCTGG - Intronic
900432896 1:2611376-2611398 CGGAGAGGGTGGGGCAGGACTGG + Intronic
900494217 1:2969160-2969182 TGGGGAGGCTGCTGCGGTCCTGG + Intergenic
901212475 1:7534386-7534408 GGGAGAGCTTGCTGCAGACCCGG + Intronic
902878874 1:19357722-19357744 GGGAGGGGGTGCAGCATTCCTGG + Intronic
903063478 1:20685580-20685602 CTGAGAGCCTGCTGCAGGCCCGG + Intronic
903189704 1:21649871-21649893 CTGGGAGGGTGGTGCAGTGCAGG - Intronic
903350598 1:22714108-22714130 CTGACAGGGTGCTGGACTCCGGG + Intronic
903686440 1:25135640-25135662 AGGAGAGGCTGATGCAGGCCAGG - Intergenic
906686206 1:47765061-47765083 AGGAGAGGCTGTTGAAGTCCTGG - Exonic
907404638 1:54246418-54246440 GGGAGAGGCGGCTGCAGTCCTGG - Intronic
910259962 1:85284921-85284943 CAGAGAGGGTGTTACAGCCCTGG - Intergenic
910723622 1:90314699-90314721 TGGTGAAGGTGCAGCAGTCCAGG + Intergenic
912044558 1:105437788-105437810 CAGAGAGGGTGTTACAGCCCTGG - Intergenic
916084551 1:161259024-161259046 CGGGGAGGGTGCTGCGGCTCGGG + Intronic
919657660 1:200213620-200213642 CAGAGAGGGTGCCGCAGCGCCGG + Intergenic
920042911 1:203115087-203115109 AGGAGAGAGAGCTGCAGTCAAGG - Intronic
920333266 1:205227733-205227755 CAGAGAGCGGGCTGCAGTTCAGG - Intergenic
920400041 1:205670675-205670697 GGGTGAGGGGGCTGCAGGCCGGG + Intronic
922699534 1:227750710-227750732 AGGCGAGGGTGCTGCGGTCCTGG + Intronic
1063030034 10:2225439-2225461 CCAGGAAGGTGCTGCAGTCCCGG + Intergenic
1064239645 10:13614691-13614713 GGGAAAGGGTGCTGGTGTCCAGG + Intronic
1064295946 10:14079294-14079316 AGGAGAGGGTGCTGGAGCCCAGG - Intronic
1064338560 10:14466551-14466573 CAGAGGGAGTGCTGAAGTCCTGG + Intergenic
1064443032 10:15370800-15370822 CGTTGCGGGTGCTGCAGGCCCGG + Intronic
1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG + Intronic
1066335082 10:34468120-34468142 TGAAGGAGGTGCTGCAGTCCAGG - Intronic
1067064799 10:43097623-43097645 GGGAGGGGGTGCTGCATTTCTGG - Intronic
1069532482 10:69229552-69229574 AGGAGGAGGGGCTGCAGTCCAGG - Intronic
1070371075 10:75782576-75782598 CGGCCAGGGTGCTGCAATTCCGG + Intronic
1070644354 10:78191231-78191253 AGGTGAGTGTGCTCCAGTCCTGG + Intergenic
1070720974 10:78756910-78756932 CTGAGAGGCTGCTGCACTTCTGG - Intergenic
1070825678 10:79389052-79389074 GGGAGGGAGTGCTGCAGTCTGGG - Intronic
1072650558 10:97291929-97291951 GGGAGAGGGATCTGTAGTCCAGG - Intronic
1073448569 10:103595693-103595715 AGGAGAGGGTGCTGTTGTCAAGG + Exonic
1074591976 10:114822050-114822072 GGGAGAGGCTGCTGCAGTCCCGG + Exonic
1075334514 10:121598525-121598547 CAGAGAGGGCGCCGCCGTCCAGG - Intergenic
1076469861 10:130710804-130710826 GGGAGATGGTGCTGGTGTCCAGG + Intergenic
1076894485 10:133303238-133303260 CTGAGAGGCTGCTGGAGTTCAGG - Intronic
1077091850 11:782249-782271 AGGACAGGGTGCAGCAGCCCCGG + Intronic
1077185624 11:1234227-1234249 CCGAGCTGTTGCTGCAGTCCAGG - Exonic
1077230174 11:1455209-1455231 GGGACTGGGTGCTGGAGTCCTGG - Intronic
1077459776 11:2703172-2703194 CTGGGAGGGGGCTGCAGTCACGG + Intronic
1077524435 11:3056027-3056049 TGGAGATGGTGCTGGAATCCAGG + Intronic
1077730476 11:4724099-4724121 AGGAGCGGCTGCTGAAGTCCTGG + Intronic
1078267561 11:9766359-9766381 CTAAGAGGGTGAGGCAGTCCTGG + Intergenic
1078345462 11:10544192-10544214 CCAAGAGGGTGTTACAGTCCTGG + Intergenic
1078549809 11:12272247-12272269 GGGAGAGAGTGGTGGAGTCCAGG - Intergenic
1083640908 11:64144764-64144786 CGGAGAGGTTTCTGCTGTCGTGG + Intronic
1083796830 11:65021762-65021784 CGGTGACGGCGCTGCAGCCCTGG - Exonic
1084961398 11:72718590-72718612 GGGAGAGGGAGCTGCAGTGCGGG - Intronic
1087200723 11:95341750-95341772 CGGAGAGGGTGCCGCAGCACTGG - Intergenic
1087846359 11:102977915-102977937 TGGAAAGGGGGCTGCAGGCCTGG + Intergenic
1088223097 11:107590698-107590720 GGGATAGGGTTCTGCAGTCCCGG + Intergenic
1089185927 11:116614687-116614709 CTGATGGGGTGCTGAAGTCCTGG - Intergenic
1089198672 11:116710493-116710515 GGGAGGGGCTGGTGCAGTCCTGG + Intergenic
1091324581 11:134676790-134676812 CAGAGACGCAGCTGCAGTCCAGG + Intergenic
1091800804 12:3323422-3323444 CGGTGAAGGTGCTGGAGGCCAGG + Intergenic
1093741359 12:22693190-22693212 CGGAGAGGTGGCTGGAGGCCCGG + Intergenic
1093943276 12:25079269-25079291 CTGAGAGCCTGCTGCAGTCCAGG + Exonic
1096249468 12:50019552-50019574 GGGAGAGGGAGCAGAAGTCCTGG + Intronic
1097198447 12:57258075-57258097 AGGAGAGGGTGCTGGAGACTGGG + Exonic
1098444577 12:70552981-70553003 GGGAGAGGGTGCTGCTGTTCTGG + Exonic
1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG + Intergenic
1101896296 12:108759545-108759567 CGGACAGATTGCTTCAGTCCAGG + Intergenic
1103702292 12:122854125-122854147 GGTAGAGGTGGCTGCAGTCCTGG - Exonic
1104092222 12:125526559-125526581 CTGAGAAGGTGCTGCTGTCCTGG + Intronic
1104691023 12:130826463-130826485 AGCAGAGGGCGCTGCAGGCCCGG + Intronic
1106267097 13:28120243-28120265 GGGAGAAGGGGCTGCATTCCAGG + Intergenic
1108998299 13:56763308-56763330 CGGAAAGGGTGCTGAAGCCAGGG + Intergenic
1112229949 13:97579787-97579809 CAGAGAGGGCTCTGCAGACCGGG - Intergenic
1115946489 14:38666998-38667020 CTGAGAGGGTGGGGAAGTCCAGG + Intergenic
1117072438 14:52069038-52069060 CGGAGAGTGGGCTGGAGGCCGGG - Intronic
1117285412 14:54282071-54282093 CGGAGAGGGTGTCATAGTCCTGG + Intergenic
1118982436 14:70727642-70727664 CTGAGAGAGTGCAGCAGTCAGGG + Intronic
1119442034 14:74634929-74634951 AGGAGAGGGAGATGCAATCCAGG - Intergenic
1119548667 14:75492367-75492389 TGGAGAGGGAGCTGTAGTCAGGG - Intergenic
1119619095 14:76118264-76118286 CGGAGAGGGCGAGGGAGTCCGGG + Intergenic
1120906543 14:89625664-89625686 CGCAGAGGCTGCTGGAGACCGGG + Intergenic
1122466598 14:101938085-101938107 CCCAGAGGGTGATGCTGTCCAGG - Intergenic
1123025874 14:105423662-105423684 CGGACAGGGTGCTTCCGCCCAGG - Intronic
1123161939 14:106287094-106287116 GGGAGATGGAGCTGCAGACCCGG - Intergenic
1124008195 15:25811245-25811267 CAGAGAGCCTGCTGGAGTCCAGG - Intronic
1125601664 15:40918882-40918904 GGGGGAGGGTGCTGCAGGCCAGG - Intergenic
1125673083 15:41487313-41487335 CAGAGAGGGTGCTGGAGGGCTGG - Intergenic
1126037821 15:44563854-44563876 AGGAGAGGGTGCTGGAGTCTGGG + Intronic
1128332285 15:66763550-66763572 TGGAGAGGGTGCGTCGGTCCTGG - Intronic
1128935995 15:71747060-71747082 TGGAGAGGGAGCTGCAGAGCGGG - Intronic
1129288641 15:74546164-74546186 CGGCCAGGGTGCTGCTGTCGTGG - Intronic
1130256334 15:82327702-82327724 AGGAGTGGGTGCTGCTGACCGGG - Intergenic
1130598618 15:85262286-85262308 AGGAGTGGGTGCTGCTGACCGGG + Intergenic
1132374766 15:101321710-101321732 TGGTGAGGATGCTGCGGTCCAGG - Intronic
1132669858 16:1098110-1098132 CGGAGAGGGGGCGGCCCTCCCGG - Intergenic
1132759758 16:1502896-1502918 GGGAGAGGCTGCTGTGGTCCGGG - Intronic
1133756834 16:8768204-8768226 AGGAGAGGATGCTGTAGTCGGGG - Exonic
1134202499 16:12210570-12210592 GGGAGAGGGAGCTTCAGGCCTGG - Intronic
1134254663 16:12601298-12601320 CAAAGAGGGTGTTACAGTCCTGG - Intergenic
1135534616 16:23283751-23283773 CGGAGATGGTGAAGCAATCCTGG + Intronic
1137001171 16:35232436-35232458 GGGAGATGCTGCTGCTGTCCAGG - Intergenic
1137620071 16:49870186-49870208 AGGAGAGGGTTCTGCATTTCTGG - Intergenic
1137731446 16:50693508-50693530 AGGAGCGGGTGCTGCGGTCCCGG + Intergenic
1139573219 16:67826120-67826142 GGGAGAGGGAGCTGGAGTCTGGG - Intronic
1139750008 16:69104075-69104097 CGGAAGGGCTGCTGGAGTCCAGG + Intergenic
1140356163 16:74308613-74308635 TGGAGAGGGTCCTGAAGTCAAGG + Intergenic
1140953970 16:79845371-79845393 CGGAAAGGGTCCTGCTGTCTGGG - Intergenic
1141429676 16:83965212-83965234 GGAAGAGGGGGCTGGAGTCCTGG - Exonic
1142509424 17:385047-385069 CGGGGACGGGACTGCAGTCCTGG + Intronic
1143166448 17:4899438-4899460 CGGAGGGGGCGGTGCAGCCCGGG - Intronic
1143200718 17:5111509-5111531 CGGGGAGGGGGCTGTCGTCCAGG + Intronic
1145234393 17:21198536-21198558 CATAGAGGGTGCAGCAGGCCAGG + Exonic
1146720450 17:35119888-35119910 CGCAGATGGCGCTGCAGGCCAGG - Intronic
1147874307 17:43610173-43610195 CGGAGTGAGTGCTGGAGTCCAGG - Intergenic
1150284102 17:63945814-63945836 GGGGGAGGGAGCTGCAGGCCTGG + Intronic
1150372581 17:64653110-64653132 CGGTGGGGGAGCTACAGTCCGGG + Intronic
1150415473 17:64984771-64984793 AGGAAAGGGTGCTGCAATCCAGG + Intergenic
1150796198 17:68239266-68239288 AGGAAAGGATGCTGCAATCCAGG - Intergenic
1151524488 17:74655045-74655067 GGGAGGAGGTGCTGCAGCCCAGG - Intergenic
1151706670 17:75772772-75772794 AGCAGAGGCTGCAGCAGTCCAGG - Intergenic
1151994652 17:77601011-77601033 CAGAGCGGGGGCTGGAGTCCAGG + Intergenic
1152130862 17:78475611-78475633 CGGAGAGGGTGACCCGGTCCAGG + Intronic
1152144447 17:78559844-78559866 CCGAGAGCCTGGTGCAGTCCAGG - Intronic
1152597672 17:81245885-81245907 CGGGGAGGACGCTGCTGTCCAGG - Exonic
1152716912 17:81904662-81904684 CGGAGAGCCTGCTGCAAACCAGG + Exonic
1152722251 17:81928793-81928815 AGGAGACGGAGCTGCACTCCTGG - Intergenic
1152809658 17:82375500-82375522 CGGAGGGGCGGCTGGAGTCCAGG + Exonic
1156495020 18:37520007-37520029 AGGAGAGGGTGGTGACGTCCTGG - Intronic
1156865639 18:41886001-41886023 CAGAGAGTGTGCAGCATTCCTGG + Intergenic
1158317510 18:56227786-56227808 CCCAGAGGGGGCTGCAATCCCGG + Intergenic
1160212658 18:76895458-76895480 CGGTGTGGGTGCTGCATTGCGGG - Intronic
1161399050 19:4059552-4059574 CCCAGAGAGGGCTGCAGTCCTGG + Intronic
1162441513 19:10695312-10695334 GGGAGCGGGTGCTGAGGTCCTGG - Intergenic
1162547361 19:11338922-11338944 CGGAGAGGCTGCAGAAGGCCTGG + Intronic
1164839316 19:31380638-31380660 CTGAGAGGAGGCTGCGGTCCTGG + Intergenic
1166282984 19:41807558-41807580 GGGAGAGGCTGCTCCTGTCCTGG + Intronic
1166405891 19:42521718-42521740 GGGAGAGGCTGCTCCTGTCCTGG - Intronic
1168353286 19:55688247-55688269 CTGAGAGGATGCTGCAGTGGAGG + Intronic
1168643461 19:58045020-58045042 CAGAGATGGTGGTGAAGTCCCGG + Intronic
925822756 2:7816453-7816475 CTGTGAGGCTGCTGTAGTCCTGG + Intergenic
929597836 2:43187241-43187263 AGCAGATGGTGCTGCTGTCCAGG - Intergenic
933744517 2:85561131-85561153 TGGAGAGGGGGCTGCACTGCAGG - Intronic
935037883 2:99396608-99396630 CAGGCAGGGTGCTGCAGCCCAGG - Intronic
935338145 2:102035792-102035814 AGGAGAGGGGACTGCAGTCAAGG + Intergenic
938199163 2:129358756-129358778 CGGGCAGGGTGCAGCAGTCATGG + Intergenic
939569937 2:143829236-143829258 TGCAGAAGGGGCTGCAGTCCTGG + Intergenic
939855800 2:147357273-147357295 AGGAGAGGGTGCTGTTTTCCTGG + Intergenic
941013808 2:160331871-160331893 CAGGGAGGGTGCTGCAGAGCAGG + Intronic
942890410 2:180980785-180980807 CGGAGGGGGTTGTGCAGTGCCGG - Exonic
944187456 2:196965029-196965051 CAGAAAGGATGCTGCAGTCAGGG - Intergenic
946389029 2:219404576-219404598 GGGTGGGGGTGCTTCAGTCCAGG + Intergenic
947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG + Intronic
1170561036 20:17558786-17558808 TGGAGAGGGTTTTGGAGTCCTGG - Intronic
1170732760 20:18988759-18988781 CTGAGAGGGGGGTGCAGGCCAGG - Intergenic
1172688976 20:36777724-36777746 TGGTGAGGGTCCTGCAGTCATGG - Exonic
1173969105 20:47137375-47137397 TGGAGTGCCTGCTGCAGTCCAGG + Intronic
1174400496 20:50273423-50273445 AGGAGAGGGTGGTGGAGACCAGG + Intergenic
1175968424 20:62671640-62671662 TGGTGAGGGTGCTGCAGGCTGGG + Intronic
1179059334 21:37965247-37965269 CCCAGAGGGAGCTGCAGTCAGGG - Intronic
1179362800 21:40728080-40728102 CGGAGGGGGCGCTGCAGTAGTGG - Intronic
1179610150 21:42545018-42545040 TGGAGCGGGTGCTGAGGTCCCGG - Intronic
1180175617 21:46085746-46085768 GGGGGAGGGTCCTGGAGTCCTGG - Intergenic
1183381438 22:37492370-37492392 CAGAGCGGGTGCTGCTGTTCTGG - Intronic
1183749219 22:39710221-39710243 CGGAGAGGGTTTTGCAGCTCGGG - Intergenic
1184643244 22:45883157-45883179 CGGCAAGGGTGCTGCTTTCCTGG + Intergenic
1185173286 22:49305542-49305564 CAGAGAAGCTGCTGCAGCCCTGG - Intergenic
1185263356 22:49883926-49883948 CGTATAGGGTGCTGCTGTACTGG - Exonic
1185351563 22:50342382-50342404 CGAGGAGGGTGCTGCTGACCAGG + Intergenic
949875689 3:8624789-8624811 AGGAGAGGGTCCTGCGGGCCAGG - Intronic
950451673 3:13068913-13068935 CTGAGAGGGTGCTGCTCTCAGGG - Intronic
954850612 3:53596603-53596625 CGGAGAAGGAGCTGCAGTGATGG + Intronic
955103543 3:55874873-55874895 CTGAGAGGGAGCTACAGTCATGG + Intronic
955417672 3:58707623-58707645 TGAAGATTGTGCTGCAGTCCAGG - Intergenic
960903798 3:122577783-122577805 CGGGGAGCGTGCTGCCGGCCGGG + Exonic
961016185 3:123470030-123470052 CAGAGATGGTGCAGCAGTGCAGG - Intergenic
961475067 3:127141073-127141095 TGGGGTGGGGGCTGCAGTCCTGG + Intergenic
961634673 3:128325492-128325514 CGGAGAGCCTGCTGCAGAACAGG - Intronic
961714914 3:128851693-128851715 TGGAGAGGGTGCTGGCTTCCCGG + Intergenic
962069079 3:132014237-132014259 CTGAGAGGGTGCTCCATTCCTGG - Intronic
965206079 3:165720250-165720272 CAAAGAGGGTGTTGCAGCCCTGG + Intergenic
967813654 3:193781148-193781170 CGGGGTGGGGGCTGCAGACCTGG + Intergenic
969413061 4:7042464-7042486 GGAAGAGGCTGCTGCAGCCCCGG - Exonic
969618178 4:8265685-8265707 CGCAGACGGTGCTGCTGTCCTGG - Intergenic
969699660 4:8761234-8761256 AGGAGAGAGAGCTGCAGACCTGG - Intergenic
971733011 4:30409864-30409886 CGGGCAGGTTGCTTCAGTCCAGG + Intergenic
976875779 4:89851600-89851622 AGGAGAGGATGCTGCATTCGAGG - Intergenic
984493659 4:180468589-180468611 GGGAAAGGGGGCTGCAGTCAGGG + Intergenic
984820343 4:183876323-183876345 CAGAGAGTGTGCAGCAGGCCCGG + Intronic
985656913 5:1137131-1137153 CAGTGAGGCCGCTGCAGTCCCGG + Intergenic
987421759 5:17728963-17728985 CGGGGACAGTGCCGCAGTCCAGG - Intergenic
992265031 5:75009901-75009923 CGGAGAGGATGGGGCAGGCCAGG + Intergenic
992716261 5:79514074-79514096 AGAAGAGGGTGCTGCTTTCCCGG + Exonic
994609505 5:102018731-102018753 CGGAAAGGGCGCTGAAGTCAGGG + Intergenic
995183050 5:109246763-109246785 CAGAGAGGGTCCTGCAATCTAGG + Intergenic
997694683 5:135851848-135851870 AGGAGGGGGTGCTGCAGGCCGGG - Intronic
999661138 5:153863875-153863897 CCAACAGGGTGCTGCAGTCAGGG - Intergenic
1004709395 6:18155518-18155540 CGGAGAGGCGCCCGCAGTCCAGG + Exonic
1006379981 6:33691771-33691793 CGGAGAGTGTGCTGAGGCCCGGG - Intronic
1006612768 6:35304563-35304585 CAGAGAAGGTGCAGCAGGCCAGG + Intronic
1006615224 6:35321495-35321517 AGGAGAGGGAGCTGAGGTCCTGG + Exonic
1007254616 6:40520227-40520249 AGGAGATGATGCTGCAGTTCTGG + Intronic
1007497174 6:42268243-42268265 GGGGGAGGGTGCTGCTGACCCGG + Exonic
1007606882 6:43123822-43123844 CGCAGAGGGTGCTGCTTCCCCGG - Intronic
1008179639 6:48312461-48312483 CTGAGGGGATACTGCAGTCCTGG - Intergenic
1016392829 6:143592077-143592099 AGGAGTGGGTGCTTCAGGCCAGG + Intronic
1017298699 6:152831281-152831303 TGGCGAGGGTGTTGCATTCCTGG + Intergenic
1018366090 6:163121515-163121537 CAGAGAGGCCGCAGCAGTCCTGG - Intronic
1018942520 6:168319141-168319163 CGGAGCGCGGGCTGCAGCCCCGG + Intronic
1019327783 7:446655-446677 CGGACTGGGTGCTGCAGACAGGG - Intergenic
1019927472 7:4202841-4202863 AGGTGAGGGGGCTGCAGCCCAGG + Intronic
1019993953 7:4711359-4711381 GTGAGAGGGTGTGGCAGTCCGGG + Intronic
1023259191 7:38341419-38341441 CACAGAGGGTGCTGCAGAACTGG - Intergenic
1023866833 7:44242365-44242387 CTGAGAGGGAGCTTCAGGCCCGG - Intronic
1024564897 7:50673008-50673030 GGGAGAGGGTGCAGCGGCCCTGG - Intronic
1025928913 7:65979930-65979952 CGGGGAGGGGGCTGCAGGTCAGG + Intronic
1026909857 7:74085192-74085214 AGGGGAGGGGGCTGCAGACCTGG - Intronic
1027230327 7:76268352-76268374 GAGAGAGGGGGCTGCAGTGCTGG + Intronic
1028496104 7:91463103-91463125 CGGAGAGGGGGCTGCACTCTGGG + Intergenic
1029402992 7:100357042-100357064 GGTAGAGGGGGCTCCAGTCCTGG + Intronic
1030612653 7:111706178-111706200 TGGAAAGGGTGCTGAAGCCCGGG - Intergenic
1031683947 7:124709343-124709365 GGCAGAGGCTGCTGCAGTCAGGG - Intergenic
1032064368 7:128754573-128754595 CGGAGGGGGAGCTGAAATCCTGG + Exonic
1032441768 7:131947600-131947622 GGGAGAGGGTGGGGCAGGCCAGG + Intergenic
1033477103 7:141701959-141701981 CGGAGGTGCTGCTGCAGCCCGGG - Exonic
1034150807 7:148914204-148914226 GGGAGAGGTGGCTGCAATCCTGG + Intergenic
1034285253 7:149879696-149879718 TGGAGAGGGTGCTCCGGCCCAGG + Exonic
1035676920 8:1462567-1462589 GGGAGAAGGTGCTGCTGTCACGG + Intergenic
1040480255 8:47819075-47819097 CTGAGAGGGTGCAGGACTCCTGG - Intronic
1045059903 8:98402575-98402597 CGGAGGGGGCCCTGCTGTCCTGG + Intronic
1047928314 8:129702209-129702231 CGTGGAGGGTGCTTCAGTCTTGG - Intergenic
1048616689 8:136082656-136082678 TGGAGAGCGTGCTGAAGTACTGG - Intergenic
1049272648 8:141704108-141704130 CGGTGATGGTGCTGCAGAGCGGG - Intergenic
1049833470 8:144717626-144717648 TGGAGATGGAGCTGGAGTCCTGG - Intergenic
1056550125 9:87645955-87645977 CCCAGAAGGTGCTGCAGGCCTGG - Exonic
1057903537 9:98967362-98967384 AGGAGAGGGTTCTGCAGGCAGGG - Intronic
1058885949 9:109321040-109321062 AGGAGGGCGTGCTGCAGTCCCGG - Intergenic
1059055351 9:110973355-110973377 CGGAGTTGCTGCTGTAGTCCTGG - Intronic
1061652751 9:132064265-132064287 CGGAGGAGGTGCTGAAGTCAGGG + Intronic
1062279367 9:135745049-135745071 GGCAGCGGGTGCTGCATTCCCGG - Intronic
1062297588 9:135841013-135841035 TGGAAAGGGTGCTGAAGTCAGGG + Intronic
1062564184 9:137156621-137156643 CGGTGGGAGTGCTGGAGTCCTGG + Intronic
1186276027 X:7939037-7939059 CTGAGATGGGGATGCAGTCCTGG + Intergenic
1187079915 X:15975240-15975262 CGGAGAGGGAGGTGGACTCCAGG - Intergenic
1189144413 X:38641186-38641208 TGGAGAGGGGGCTGCACTCTGGG - Intronic
1189586569 X:42467973-42467995 GGAAGAGGGTGGTGCAGCCCTGG + Intergenic
1190065492 X:47239127-47239149 CAGGGAAGGTGCTGGAGTCCTGG - Exonic
1190365465 X:49689463-49689485 CGGAGATGGTCCTGATGTCCAGG - Exonic
1190637307 X:52448632-52448654 CGGAGATGGTCCTGATGTCCAGG - Intergenic