ID: 1065239929

View in Genome Browser
Species Human (GRCh38)
Location 10:23694986-23695008
Sequence GCGCCCTGCGCAGCATCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065239919_1065239929 30 Left 1065239919 10:23694933-23694955 CCCTGAAACTGCAAGTCGGGCAG 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1065239920_1065239929 29 Left 1065239920 10:23694934-23694956 CCTGAAACTGCAAGTCGGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1065239926_1065239929 1 Left 1065239926 10:23694962-23694984 CCCGGCGGAGGAGCAGGGCGCGC 0: 1
1: 0
2: 2
3: 26
4: 245
Right 1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1065239927_1065239929 0 Left 1065239927 10:23694963-23694985 CCGGCGGAGGAGCAGGGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065239929 Original CRISPR GCGCCCTGCGCAGCATCCCC GGG Intronic
900087115 1:904037-904059 GTGCCCAGCCCAGCATCCCGGGG + Intergenic
900335323 1:2160379-2160401 GCTCCCTGCGGACCCTCCCCGGG - Intronic
900435353 1:2628499-2628521 GCGCCCTACGCACCTGCCCCGGG + Intronic
900482982 1:2908317-2908339 GCACCCAGCACAGTATCCCCGGG + Intergenic
900981972 1:6051038-6051060 GTGCCCTGCGCTGCTTTCCCAGG + Intronic
903579240 1:24358481-24358503 CCACCCTGCCCAGCGTCCCCAGG - Exonic
904314765 1:29653095-29653117 GCGACTGGCCCAGCATCCCCTGG + Intergenic
906147290 1:43567592-43567614 GAGCCTTGGGGAGCATCCCCTGG + Intronic
913144545 1:115976550-115976572 CCGCCCAGCGCGGCAACCCCTGG - Exonic
917331611 1:173886077-173886099 GAGCCCTGGACAGCTTCCCCAGG - Exonic
920550600 1:206857552-206857574 GAACCCCGCCCAGCATCCCCGGG + Intergenic
920655123 1:207868916-207868938 GGGCCCTGGGCATCGTCCCCAGG + Intergenic
920866855 1:209760267-209760289 GGGCAAAGCGCAGCATCCCCAGG + Exonic
922764669 1:228150703-228150725 CCTCCCTGCGCAGCAGCCCTGGG - Intronic
923052684 1:230399710-230399732 GTGCCCTCAGCAGCATCCTCCGG - Intronic
924511415 1:244731297-244731319 GGGGGCTGCGCAGCCTCCCCTGG + Intergenic
1063115572 10:3069117-3069139 GCCCGCAGCGCAGCCTCCCCAGG + Intronic
1064879236 10:20031617-20031639 GTGCCCTGGGCTGCATGCCCAGG + Intronic
1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG + Intronic
1066471380 10:35701413-35701435 GCCCCCTCCGGAGCAGCCCCAGG + Intergenic
1067022954 10:42818012-42818034 GCAACCTGCTCAGCATCCCCAGG - Intronic
1067155606 10:43779037-43779059 GCTCCTTGGGCAGCTTCCCCAGG - Intergenic
1069703280 10:70441433-70441455 GCGCCCTGCTGGGCACCCCCGGG - Intronic
1071511070 10:86262898-86262920 GCTCCCTGCGCGGCGTTCCCAGG + Intronic
1074577453 10:114683805-114683827 TGGTCCTGCTCAGCATCCCCAGG - Intronic
1076478610 10:130769417-130769439 GCACCCTGCCCAGCCACCCCTGG + Intergenic
1076887160 10:133268118-133268140 GCGCCCTGTGCTTCCTCCCCAGG - Exonic
1077158341 11:1101479-1101501 GCACTCTGCGCAGCATGTCCGGG + Intergenic
1083756789 11:64796272-64796294 TCACCCAGCGCATCATCCCCAGG - Exonic
1084429092 11:69101527-69101549 GTGCCCAGGGCAGCATCTCCAGG - Intergenic
1084833640 11:71787607-71787629 GCGCCCTGCGCTCCTTCCGCTGG + Exonic
1085507130 11:77066997-77067019 CCGCCCGGCGCAGCAGCCTCGGG - Exonic
1088400921 11:109422343-109422365 GCGGCCTGAGCAGCCACCCCTGG + Intronic
1089125444 11:116173268-116173290 GCCCCCTCCTCTGCATCCCCAGG + Intergenic
1089125619 11:116174597-116174619 CCCCCCTGCCCACCATCCCCTGG + Intergenic
1091307267 11:134544281-134544303 GCGACCAACGCAGCATCCGCAGG + Intergenic
1091444152 12:534066-534088 GTGCCCAGCGCAGCATCCTGGGG + Intronic
1101903163 12:108806673-108806695 ATGCCCAGCGCAACATCCCCAGG + Intronic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1102159322 12:110755813-110755835 CTGTCCTGCTCAGCATCCCCTGG - Intergenic
1102197340 12:111034630-111034652 GCGCGCTCCGCGGCCTCCCCGGG - Intronic
1103407765 12:120687561-120687583 GCGCCCAGCACAGCAGGCCCTGG - Intronic
1103595312 12:122021721-122021743 GCGCCCTTCGCCACCTCCCCAGG + Exonic
1104021386 12:124994386-124994408 GCGCCCTCCCCAGCTACCCCGGG + Intronic
1104733544 12:131122194-131122216 GCGCCCCGCGCAACACCCCTGGG - Intronic
1107603792 13:42040061-42040083 GTGCCCGGCGCAGCTTGCCCTGG + Intronic
1108470610 13:50763186-50763208 GAGCCCTCCCCAGCGTCCCCAGG - Intronic
1111747748 13:92291266-92291288 CCGCCCTGTGCAGGATCCACTGG + Intronic
1112173160 13:96994372-96994394 GGGCGGTGCGCAGCCTCCCCGGG - Intronic
1119480593 14:74955496-74955518 GCGCCCGACGGACCATCCCCGGG - Exonic
1119743288 14:77027721-77027743 GCGACCTGCCCCGCATGCCCTGG - Exonic
1121570494 14:94943166-94943188 TCTCCCTCCCCAGCATCCCCTGG + Intergenic
1122232586 14:100314100-100314122 GAGCCCTACGCAGCTGCCCCAGG - Intergenic
1122866123 14:104604774-104604796 CCGCCCGGCGCAGCCTCCCGCGG - Exonic
1123424105 15:20155161-20155183 GCAACCTGCTCAGCACCCCCAGG - Intergenic
1123533325 15:21161690-21161712 GCAACCTGCTCAGCACCCCCAGG - Intergenic
1124211130 15:27765970-27765992 GCCCGCTGGGCAGCATTCCCAGG - Intronic
1125525282 15:40370325-40370347 GCGCCCTGTCCAGCCTCCCCGGG - Exonic
1125933348 15:43615624-43615646 GGGCCCGACCCAGCATCCCCTGG + Exonic
1125946446 15:43715086-43715108 GGGCCCGACCCAGCATCCCCTGG + Intergenic
1126466106 15:48962931-48962953 TGGCCCTGTGCAGCATCCCGGGG + Exonic
1127954000 15:63836560-63836582 GCCCTCTGAGCAGCATACCCTGG + Intergenic
1129330186 15:74823167-74823189 GCCTCCTCCACAGCATCCCCAGG - Intronic
1131227636 15:90638577-90638599 GGCCCCTGCCCAGCAGCCCCAGG + Exonic
1132494466 16:254727-254749 GCCCCCTCCGCCCCATCCCCTGG - Intronic
1132580482 16:682524-682546 GAGCCCTGGGCAGAAGCCCCCGG + Exonic
1132754209 16:1474815-1474837 GCGCCCTGCCCGGCCTCACCTGG + Exonic
1133046073 16:3089046-3089068 GCGCCCTGCGCCACCTACCCGGG - Exonic
1135480016 16:22814449-22814471 GCACCCTGGTCAGCAGCCCCCGG + Exonic
1136636845 16:31529576-31529598 CCGCCCCGCGCACCCTCCCCCGG - Intergenic
1141693640 16:85610206-85610228 GCACCGCGTGCAGCATCCCCAGG + Intergenic
1141824368 16:86468632-86468654 GCACCCTCCGCACCATCCCTGGG + Intergenic
1142115714 16:88355077-88355099 GCCCCCTGCCCACCCTCCCCAGG - Intergenic
1142150729 16:88511491-88511513 CCACCCAGCTCAGCATCCCCCGG + Intronic
1142197086 16:88743963-88743985 GAGCCCTGCACAGCACCCCCTGG - Intronic
1144677547 17:17171557-17171579 GCGCCCTGAACAGGATCCCTGGG - Intronic
1144893591 17:18510759-18510781 CCGCTCTGCTCACCATCCCCCGG + Intergenic
1145138632 17:20433515-20433537 CCGCTCTGCTCACCATCCCCCGG - Intergenic
1145937871 17:28725852-28725874 GCTCCCCGCTCAGGATCCCCTGG + Intronic
1146633564 17:34487836-34487858 TGGCCCTGCGCTGCCTCCCCTGG + Intergenic
1147580360 17:41624351-41624373 GCGGCCTGGGCAGCACCCTCGGG - Exonic
1147722228 17:42546475-42546497 GCCCCCTGGGCAGATTCCCCTGG - Intergenic
1147723412 17:42552645-42552667 GCCCCCTGGGCAGATTCCCCTGG - Exonic
1148341320 17:46875161-46875183 GCGCCCAGCGCTGCAGGCCCGGG - Exonic
1151235219 17:72715062-72715084 GCGACCAGTGCAGCATCCCAGGG + Intronic
1151973532 17:77471337-77471359 GCAGCCTCTGCAGCATCCCCAGG + Intronic
1152357273 17:79813334-79813356 GCGCCCGGCCGAGCGTCCCCGGG + Intergenic
1152515181 17:80819160-80819182 GCTCCCTCCCCAGCATCACCAGG + Intronic
1152924543 17:83081043-83081065 GCCCCCGGCGGAGCCTCCCCGGG + Intronic
1154388034 18:13913218-13913240 GCTCCCTGCACAGCCTCACCTGG + Intronic
1155107516 18:22682195-22682217 ACGCCCTGCACAGCACCCCATGG - Intergenic
1156213988 18:34977592-34977614 GCGCGCTTGGGAGCATCCCCTGG + Intronic
1157386298 18:47261810-47261832 GAGCCCTTCTCAGCATCTCCAGG + Intergenic
1160015122 18:75134247-75134269 AGGCCCTGGGCAGCATCCTCTGG - Intergenic
1160322699 18:77911395-77911417 TAGACCTCCGCAGCATCCCCTGG + Intergenic
1160452385 18:78974277-78974299 GCGACCCTCGCAGCCTCCCCTGG + Intergenic
1160454608 18:78992079-78992101 GCGTCCTCCGCACCTTCCCCCGG - Exonic
1160542818 18:79634427-79634449 GGGCCCCTCGCTGCATCCCCAGG - Intergenic
1161590870 19:5128625-5128647 GCGGCCTCTGCAGCCTCCCCGGG + Intronic
1162124220 19:8490565-8490587 GCGCCCGGCCCCGCAGCCCCGGG - Intronic
1163604076 19:18264731-18264753 GCGCCATGCTCAGCATGCTCTGG + Exonic
1166861672 19:45815128-45815150 GCGCCCTGCCCAGCAGCCTCCGG - Exonic
1167795220 19:51704316-51704338 GCGCCCAGCGCAGCACTTCCCGG - Intergenic
1168115893 19:54221218-54221240 GCGCCCTGGCCAGCAGCCCCAGG - Exonic
1168118876 19:54240966-54240988 GCGCCCTGGCCAGCAGCCCCAGG - Exonic
1168133816 19:54337535-54337557 GCGCCCTGGCCGGCAGCCCCAGG - Exonic
1168166518 19:54552095-54552117 GCGCCCTGGCCAGCAGCCCGAGG + Intergenic
1168185592 19:54697788-54697810 GCGCCCTGGCCAGCAGCCCCAGG + Intronic
1168247087 19:55117707-55117729 GCGACCTGCCCAGCACACCCTGG - Intergenic
1168652154 19:58098141-58098163 GACCCCCGCGCTGCATCCCCGGG + Intronic
1168667656 19:58216890-58216912 GGGCCCTGGTCAGCCTCCCCAGG - Intergenic
927278158 2:21279338-21279360 CCTCCCAGAGCAGCATCCCCTGG - Intergenic
927885790 2:26717736-26717758 GGGCCCTGCCCAGGACCCCCAGG + Intronic
929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG + Intergenic
932562804 2:72887674-72887696 GCGCCCTGCGCGAGCTCCCCCGG + Exonic
934459142 2:94201878-94201900 GCAACCTGCTCAGCAACCCCAGG + Intergenic
935746538 2:106194226-106194248 GCGCCTTGCTCACCATCCCCGGG + Exonic
937820295 2:126302866-126302888 TTGACCTGCTCAGCATCCCCTGG + Intergenic
938034721 2:128027139-128027161 GGGCCCTCCGCGGCACCCCCAGG - Exonic
938065940 2:128282094-128282116 GCGTCCTGAGCAGCATTGCCAGG - Intronic
938380940 2:130836408-130836430 GCGCGCTGCACAGCCTCCCTGGG + Intergenic
938407360 2:131039940-131039962 GCGCCCTGCGCCGCAGCGGCGGG - Intronic
945139660 2:206671086-206671108 GCGCCCTGAACTGCAACCCCAGG + Intronic
1170566478 20:17610822-17610844 GCGCCCTGACCAGCTTCCTCAGG - Intergenic
1171011028 20:21509587-21509609 GCACTCTGCGCAGCAGCCCAGGG - Intergenic
1171417398 20:24992481-24992503 GCGCTCGGCACCGCATCCCCAGG + Intronic
1173067575 20:39727960-39727982 GCCACCTGCTCAGCATCTCCAGG + Intergenic
1174296659 20:49550147-49550169 TGGACCTGGGCAGCATCCCCTGG - Exonic
1175800553 20:61798754-61798776 GAGTCCTCCGCAGCAGCCCCAGG + Intronic
1176097328 20:63350105-63350127 GCTCCCTCCTCAGCAGCCCCTGG - Exonic
1179243833 21:39613074-39613096 GCGCCCCGCGCCCCAGCCCCGGG - Intronic
1179914114 21:44465185-44465207 GCACCCTGGGCACCGTCCCCAGG + Intergenic
1181265673 22:21629350-21629372 GGGCCCTGCCCAGCAGCTCCCGG + Exonic
1181386690 22:22550957-22550979 GCTCCCTGGGCAGCAACTCCAGG + Exonic
1181473793 22:23156500-23156522 GAGCCCTGCCCAGCACCACCTGG - Intronic
1182237745 22:28889691-28889713 GTGCACTGCGCAGCATCCTTGGG + Intronic
1183486358 22:38089397-38089419 CCGCTCTACGCTGCATCCCCCGG - Intronic
1184850072 22:47114992-47115014 GAGCCCTGCCCAGCAGGCCCTGG - Intronic
1185138943 22:49089567-49089589 CCTCCCTGCGCGGCACCCCCAGG + Intergenic
1185322926 22:50210177-50210199 GCGCCGTGCGCCGCGTCACCTGG - Exonic
951592180 3:24278463-24278485 GAGCTCTGCTCAGCATCTCCAGG + Intronic
954151821 3:48661746-48661768 GCGCCCCGGGCCGCGTCCCCCGG - Exonic
954418942 3:50408420-50408442 GGGCCCTCAGCATCATCCCCGGG - Intronic
961300116 3:125916694-125916716 GCGCGCTGCGCTCCTTCCCCTGG + Intergenic
973246726 4:48017329-48017351 GCGCCCTGCGCTGGCTCCCGGGG + Intronic
977838612 4:101674301-101674323 GGGCCCTCCGCAGCATCCCAGGG - Intronic
979928266 4:126595261-126595283 GCACCCTGGGCAGAATCCCCTGG + Intergenic
985017426 4:185651125-185651147 GAGCCCTGGGCAGAATCCCGAGG + Intronic
985529165 5:423854-423876 GGGCCCTGAGCAGCCTCCCCAGG - Exonic
985677358 5:1238932-1238954 ACTCCCTGCCCAGCATCCCGAGG + Intronic
985822641 5:2170468-2170490 GTTCCCTGCACAGCGTCCCCTGG + Intergenic
987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990823016 5:59864198-59864220 GACCACTGCTCAGCATCCCCTGG - Intronic
995512234 5:112921498-112921520 GCGCTTTGCGCAGCAACCCCCGG + Intronic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
999269723 5:150289762-150289784 GTGCCCTGCTCAGAAGCCCCGGG - Intronic
1002421172 5:179149833-179149855 GGGCTCTGCTCAGCCTCCCCTGG - Intronic
1002780233 6:359560-359582 GCCGCCAGCCCAGCATCCCCAGG - Intergenic
1003519242 6:6843459-6843481 GCGCCCTCCAGAGCATTCCCAGG + Intergenic
1004861031 6:19804888-19804910 CCGCGCTGCGCTGCCTCCCCCGG - Intergenic
1005965021 6:30721031-30721053 GCGCCCAGCGCAGCCCACCCTGG - Intronic
1007098667 6:39229668-39229690 GCGGGCGGCGCAGCCTCCCCTGG - Intergenic
1017338543 6:153291184-153291206 ACGCCCTGCTCAGCAGGCCCTGG + Intergenic
1019607627 7:1918094-1918116 GCGCCCGGCTCAGCCTGCCCCGG + Intronic
1023177510 7:37448356-37448378 GGGCCCTGCGCTTCATCCGCGGG + Intronic
1025712572 7:63926350-63926372 GCGCCCCGCGCTGCCCCCCCAGG - Intergenic
1026806909 7:73434514-73434536 GCGCCACGGGCAGCATGCCCAGG - Exonic
1026817046 7:73521635-73521657 GCGCCCCCCGCCGGATCCCCTGG + Intronic
1032677054 7:134140897-134140919 CCTCCCTGCCCAGCTTCCCCAGG + Intronic
1034425119 7:151010093-151010115 GCTCCCTGTGCACTATCCCCAGG + Exonic
1034991112 7:155548702-155548724 GGGCCCAGCCCAGCATCTCCAGG + Intergenic
1035709225 8:1699768-1699790 GGGCCCTGCACAGCATCTGCTGG + Intronic
1036912165 8:12766351-12766373 GGGGCCTGCGCAGGAGCCCCGGG + Intergenic
1037885710 8:22595073-22595095 GCCCCCTCCGCAGCATCCTCTGG - Intronic
1038450042 8:27633977-27633999 GCGCCCGGCGGGGCTTCCCCAGG + Intronic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1049544837 8:143225770-143225792 GCACCCTGCCCAGCACCCCAAGG - Intergenic
1049716425 8:144095174-144095196 GCGCGCTGCACAGCAGACCCCGG - Exonic
1053434958 9:38068519-38068541 GCGGCCTTCGCAGCCCCCCCAGG - Exonic
1053689638 9:40577665-40577687 GCAACCTGCTCAGCACCCCCAGG + Intergenic
1054274391 9:63053392-63053414 GCAACCTGCTCAGCACCCCCAGG - Intergenic
1054300885 9:63378604-63378626 GCAACCTGCTCAGCACCCCCAGG + Intergenic
1054400433 9:64711537-64711559 GCAACCTGCTCAGCACCCCCAGG + Intergenic
1054434023 9:65195793-65195815 GCAACCTGCTCAGCACCCCCAGG + Intergenic
1054496364 9:65825875-65825897 GCAACCTGCTCAGCACCCCCAGG - Intergenic
1056589195 9:87951900-87951922 GCCCCCTGCTCAGCATCTACTGG - Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1057334339 9:94144030-94144052 GTCCCCTGCACAGCAACCCCAGG - Intergenic
1060554979 9:124503550-124503572 GCGCCCCGCGCAGCGTCCCGGGG + Intronic
1060588181 9:124799703-124799725 GCCCCCTTGGCAGGATCCCCAGG - Intronic
1061007863 9:127938378-127938400 GCGCCCTCCTCACCATCGCCCGG + Exonic
1061483195 9:130907231-130907253 GCGTCCTGCCTAGCAGCCCCCGG - Intronic
1062077729 9:134601012-134601034 GCGCCCAGGGCAGAGTCCCCAGG + Intergenic
1062280505 9:135749703-135749725 GTGTCCTGAGCACCATCCCCAGG + Intronic
1062461788 9:136665464-136665486 GCGCCCTGGGCGGCCTCTCCTGG + Intronic
1062519693 9:136952515-136952537 GCTCTCTGGGCAGCATCCCCAGG - Intronic
1062562762 9:137149106-137149128 GGGCCCTGCCCAGCCTCACCTGG - Exonic
1195687916 X:107602290-107602312 CCTCCCTGGGCAGCATGCCCAGG - Exonic
1196441326 X:115722470-115722492 GCGCCACCAGCAGCATCCCCTGG + Intergenic
1196444855 X:115840459-115840481 GCGCCACCAGCAGCATCCCCTGG + Intergenic
1197719548 X:129735820-129735842 GAGCACTGCAGAGCATCCCCTGG - Intergenic
1198030694 X:132750974-132750996 GTGCCCTGCACCTCATCCCCTGG - Intronic
1200747698 Y:6916972-6916994 GGGCACTGGGCAGCATCCCAGGG - Intronic