ID: 1065241387

View in Genome Browser
Species Human (GRCh38)
Location 10:23708606-23708628
Sequence AGGCCTTGAGGCAGTCCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065241382_1065241387 3 Left 1065241382 10:23708580-23708602 CCAAGTAGAGGAGGCCCAATATG No data
Right 1065241387 10:23708606-23708628 AGGCCTTGAGGCAGTCCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065241387 Original CRISPR AGGCCTTGAGGCAGTCCTTG CGG Intronic
No off target data available for this crispr