ID: 1065244942 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:23747394-23747416 |
Sequence | TATGAAGATGATAATGGGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065244936_1065244942 | 6 | Left | 1065244936 | 10:23747365-23747387 | CCTGGGGCACTGGGGTCTCTCAG | 0: 1 1: 0 2: 4 3: 25 4: 293 |
||
Right | 1065244942 | 10:23747394-23747416 | TATGAAGATGATAATGGGGTGGG | No data | ||||
1065244932_1065244942 | 20 | Left | 1065244932 | 10:23747351-23747373 | CCTGGGCTTCGGATCCTGGGGCA | 0: 1 1: 0 2: 2 3: 15 4: 198 |
||
Right | 1065244942 | 10:23747394-23747416 | TATGAAGATGATAATGGGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065244942 | Original CRISPR | TATGAAGATGATAATGGGGT GGG | Intronic | ||
No off target data available for this crispr |