ID: 1065244942

View in Genome Browser
Species Human (GRCh38)
Location 10:23747394-23747416
Sequence TATGAAGATGATAATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065244936_1065244942 6 Left 1065244936 10:23747365-23747387 CCTGGGGCACTGGGGTCTCTCAG 0: 1
1: 0
2: 4
3: 25
4: 293
Right 1065244942 10:23747394-23747416 TATGAAGATGATAATGGGGTGGG No data
1065244932_1065244942 20 Left 1065244932 10:23747351-23747373 CCTGGGCTTCGGATCCTGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 198
Right 1065244942 10:23747394-23747416 TATGAAGATGATAATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065244942 Original CRISPR TATGAAGATGATAATGGGGT GGG Intronic
No off target data available for this crispr