ID: 1065245612

View in Genome Browser
Species Human (GRCh38)
Location 10:23753995-23754017
Sequence AACAGGGAGGAGGGGACATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065245612 Original CRISPR AACAGGGAGGAGGGGACATT GGG (reversed) Intronic
901491233 1:9597374-9597396 CAGAGGGAGGAAGGGACCTTGGG + Intronic
902380179 1:16049032-16049054 GTCAGGGAGGAGGTGACATGGGG + Intronic
902400220 1:16153343-16153365 AGCAGGGAGGTGGGGACTCTGGG + Intronic
902540281 1:17149509-17149531 AAGAGGGAGGTGGGGCCTTTGGG - Intergenic
902711467 1:18242931-18242953 AAGAGTGAGGAAGGGACAGTGGG + Intronic
903011314 1:20332653-20332675 AGCAGGGAAGAGGGGACAGTAGG - Intronic
903162226 1:21497254-21497276 AACAAGGAGGAGGAGAAAATGGG + Intergenic
903345410 1:22681145-22681167 CACAGGGAAGACGGGACATCTGG + Intergenic
903579566 1:24360722-24360744 TACAGGGATGAGGGTAGATTTGG - Intronic
903684441 1:25120509-25120531 CAGAAGGAGGAGGGGAAATTGGG - Intergenic
904013966 1:27406309-27406331 AAGAGGGAAGAGGGCACACTTGG + Exonic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905157520 1:35998180-35998202 AACAGAAAGGAGGGGAGTTTAGG - Intronic
905756216 1:40511668-40511690 AATAGCAAGAAGGGGACATTTGG + Intronic
909288792 1:73855769-73855791 TACAGGGAGGCAGGGACATTAGG - Intergenic
909571942 1:77123625-77123647 AGCTGGGAGGAGGGGACACTGGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
914875733 1:151511638-151511660 AGACGGGAGGAGGGGAGATTGGG + Intronic
914912584 1:151799731-151799753 AACAGGGAGGAGGGCACAGCAGG - Intergenic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
917738278 1:177939754-177939776 AAAAGGTAGCAGGAGACATTGGG - Exonic
918121830 1:181547143-181547165 AACAGGGCAGAGGGGGCAATGGG - Intronic
918894120 1:190317462-190317484 AAGAGGGAAGAAGGGACATATGG - Intronic
918914108 1:190612860-190612882 AAGAGTGAGGTGGGGGCATTGGG + Intergenic
918920919 1:190708721-190708743 AAGAGGGAGGAGGGGAGGTAGGG - Intergenic
919758716 1:201083120-201083142 AGCCGGGAGGAGGGCACATGTGG - Intronic
919851731 1:201677451-201677473 AAACAGGAGGAAGGGACATTGGG - Intronic
921958372 1:221008091-221008113 AGCAGGGAGGAGGGGAAAAATGG - Intergenic
922096306 1:222445885-222445907 AACACAGATGAGGGGACATGAGG - Intergenic
922463585 1:225830847-225830869 AACAGGTAGCAGGCTACATTTGG - Intronic
923333113 1:232944047-232944069 GACTGGGGGGAGGGGGCATTTGG - Intergenic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1068761489 10:60715564-60715586 GACAGGCAGGAGGGTATATTTGG + Intronic
1068858342 10:61820735-61820757 AAAAGGGAGGAGGGAAAGTTTGG - Intergenic
1069628795 10:69884539-69884561 GACAGGGAGGAGTAGACATAGGG + Intronic
1069854368 10:71431715-71431737 AAAGGGCAGGAGGGGACATCTGG - Intronic
1070825619 10:79388779-79388801 CACAGGGAGGTGGTGACATTAGG - Intronic
1071506590 10:86235514-86235536 AACAGGCATGAGGGGACCTTTGG - Intronic
1071537292 10:86444660-86444682 CCCAGGGAGGAGGGGAAAATAGG + Intronic
1072369325 10:94747782-94747804 AAAAGGGAGGAGGGCAAATCAGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073441748 10:103556395-103556417 AGCAGGGAGCAGGGTACATAGGG - Intronic
1073531017 10:104232109-104232131 AGGAGGGAGGAGGGGACTTGGGG + Intronic
1075581149 10:123619549-123619571 AAAAGGGAGGAGGGGAGAAGGGG + Intergenic
1075638678 10:124048922-124048944 AACAGAGAGGAGGGAAGATGGGG + Intronic
1076313721 10:129526302-129526324 AACAGGGAATAAGGGGCATTGGG - Intronic
1077672042 11:4166214-4166236 TTCATGGAGGAGAGGACATTTGG + Intergenic
1078437701 11:11339099-11339121 AAGAGGAAGGAGAGGACATTTGG + Intronic
1078910284 11:15724632-15724654 AAAAGGGAGAAGGGGGCATGTGG + Intergenic
1079116178 11:17641925-17641947 AACAGGGAGGTGGTGCCATTGGG - Exonic
1080780807 11:35428278-35428300 AACGAGGAGAAGGGGATATTTGG + Intergenic
1080955836 11:37094614-37094636 AACAGGGAAGAGGGTACAGGAGG - Intergenic
1083990367 11:66242823-66242845 CACAGGAAGAAGGGGACAGTCGG + Intronic
1084343660 11:68527802-68527824 AACAGGAAGGAGGAGCCTTTGGG - Intronic
1084475656 11:69387190-69387212 CAGAGGGAGGAAGGGACAGTGGG - Intergenic
1084527493 11:69705860-69705882 ATCAGGGAGGTGGGGAAATGAGG + Intergenic
1084584629 11:70050465-70050487 TACAGGGAGGAGGAGCCATAGGG - Intergenic
1084789087 11:71462177-71462199 AAAAGGGAGGAGGGTAAATGAGG - Intronic
1084995682 11:72975490-72975512 AACAGGTAGGAGAGAAGATTTGG + Intronic
1085484482 11:76850393-76850415 AACAGGCAGAATGAGACATTCGG - Intergenic
1085519144 11:77128061-77128083 GACAGGGAGGCGGGGTCATTGGG - Intergenic
1085604007 11:77881096-77881118 AACAAGAAGGAGGGGAACTTGGG + Intronic
1085827054 11:79858815-79858837 AACCGGGAGTAGAGGAGATTTGG + Intergenic
1086270275 11:85054862-85054884 GACAGGGAGCAGGGGAGATAAGG + Intronic
1088649448 11:111944515-111944537 AACAGGAAGAAGGTTACATTTGG + Intronic
1089650770 11:119911237-119911259 CAGAGGGAGGAGGGGGCAATGGG + Intergenic
1090190021 11:124761402-124761424 CAAAGGGAAGAGGGGAAATTGGG - Intronic
1090242315 11:125192768-125192790 CACAGGGAGGAAAGGACATCTGG + Intronic
1091324699 11:134677488-134677510 AACAGAGAGGAGGGAACAGGAGG - Intergenic
1092106438 12:5924990-5925012 AAGTGGGAGGAGGCGAGATTGGG - Intronic
1092112188 12:5971558-5971580 GACGGGGAGGAGGGCAGATTGGG - Intronic
1093549572 12:20391773-20391795 AACAGAGAGGAGGGGAAAAGGGG - Intronic
1093685260 12:22046842-22046864 ACCCGGGAGGAGGGGACGGTTGG - Intronic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1096005192 12:48164285-48164307 AACTGGGAGGATGAGATATTTGG - Intronic
1096070819 12:48774619-48774641 GACAGGGAGGAGGTCACATGGGG - Intronic
1097055213 12:56244997-56245019 AAGAGGGAGGAGGGGTCATCAGG + Intronic
1097554077 12:61115659-61115681 AACAGTGTGGAAGGGAAATTTGG + Intergenic
1099646326 12:85361956-85361978 AAGAGGGAGGAGGAGAGAGTAGG + Intergenic
1100669991 12:96801747-96801769 AATAGGGAGGAGGGGTAATAAGG + Intronic
1100685973 12:96986080-96986102 AAGAGGGAGGAAGGGGCCTTGGG + Intergenic
1102048818 12:109847570-109847592 AACACGGCTGAGGGGAGATTTGG + Intergenic
1102800912 12:115732925-115732947 AATATGGAGGAAGTGACATTCGG - Intergenic
1102952753 12:117041168-117041190 ATCAGGGAGGAGGGCAGAGTGGG + Intronic
1102976912 12:117213404-117213426 AAGAGTGAGCAGGGGAAATTGGG + Exonic
1104248535 12:127066706-127066728 AAGAGGCAGGAGAGGAGATTTGG + Intergenic
1105966881 13:25392989-25393011 CCCAGGGAAAAGGGGACATTTGG - Intronic
1108347447 13:49560190-49560212 AATAGAGAGGAGGGGGCAATGGG - Intronic
1112556291 13:100471841-100471863 ACTAGGGAGAAGGGGACACTGGG + Intronic
1113201144 13:107867929-107867951 AGGAGGGATGAGGTGACATTTGG + Intergenic
1113599542 13:111558707-111558729 CACTGGGAGCACGGGACATTAGG + Intergenic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1115938306 14:38580031-38580053 CACAGGAAGGAGGGTAAATTTGG - Intergenic
1116013839 14:39382516-39382538 AGCAGGCTGGAGGGGAAATTGGG + Intronic
1116349868 14:43847388-43847410 AACAGGAAAGAGGGGTCAATGGG + Intergenic
1118380427 14:65213544-65213566 CACAGGGAGGAGGGTATAATGGG + Intergenic
1119155246 14:72404397-72404419 AACAAGGCAGATGGGACATTGGG - Intronic
1119362862 14:74066247-74066269 AACAGGCAGGAAGCCACATTTGG - Intronic
1120176768 14:81302743-81302765 AACAGGCTGTAGGGGACAGTGGG + Intronic
1120950393 14:90035751-90035773 AACAGGGAGGAGGAGAACTTGGG - Intronic
1121182627 14:91941061-91941083 AACAGGGAGCATGCCACATTAGG - Intronic
1121993179 14:98581199-98581221 TACAGGCAGGAGGGGCAATTAGG - Intergenic
1122882300 14:104695588-104695610 CACTGGGAGGAGGGGTCACTGGG - Intronic
1123961357 15:25404798-25404820 CATAGGGAGTAGGGGACAATAGG - Intronic
1124002068 15:25768016-25768038 CACAGGGGTGAGGGGACTTTGGG - Intronic
1124971830 15:34496070-34496092 ACCAGGGCGGAGGGGAGACTGGG - Intergenic
1125503397 15:40252995-40253017 TACGGGGAGAAGGGGACGTTGGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126946824 15:53830851-53830873 AACAGGGAGGAGAAGAGAATAGG + Intergenic
1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG + Intronic
1128239873 15:66094488-66094510 CACAGGGCTGAGGGGACATGGGG + Exonic
1128698784 15:69788869-69788891 GACAGGGAGGAGGAGGCTTTGGG - Intergenic
1129155059 15:73712530-73712552 ACCAGTGTGGAGGGGACACTGGG + Intronic
1131102947 15:89708135-89708157 CACAGGCAGGAGGAAACATTTGG + Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1131688062 15:94792675-94792697 AAGTGGGAGCAGGGGACATTAGG + Intergenic
1132142146 15:99405110-99405132 TACAGTGGGGAGGGGAGATTGGG + Intergenic
1132382827 15:101378676-101378698 ATCAGGGAAGAGGGGACCTCAGG - Intronic
1132478233 16:153147-153169 GACAGTGAGGAGGGGACCTTGGG + Intronic
1132480179 16:163359-163381 GACAGTGAGGAGGGGACCATGGG + Intronic
1132480193 16:163401-163423 GACAGTGAGGAGGGGACCATAGG + Intronic
1132480210 16:163443-163465 GACAGTGAGGAGGGGACCGTGGG + Intronic
1132480221 16:163471-163493 GACAGTGAGGAGGGGACCGTGGG + Intronic
1132480229 16:163499-163521 GACAGTGAGGAGGGGACCGTAGG + Intronic
1132480240 16:163527-163549 GACAGTGAGGAGGGGACCGTGGG + Intronic
1132480251 16:163555-163577 GACAGTGAGGAGGGGACCGTGGG + Intronic
1132480262 16:163583-163605 GACAGTGAGGAGGGGACCGTGGG + Intronic
1132480270 16:163611-163633 GACAGTGAGGAGGGGACCTTGGG + Intronic
1132480281 16:163639-163661 GACAGTGAGGAGGGGACCATGGG + Intronic
1132480300 16:163695-163717 GACAGTGAGGAGGGGACTGTGGG + Intronic
1132480308 16:163723-163745 GACAGTGAGGAGGGGACCATGGG + Intronic
1132480327 16:163779-163801 GACAGTGAGGAGGGGACTGTGGG + Intronic
1134511365 16:14850347-14850369 AAGAGGGAGGAGGGGGACTTCGG + Intronic
1134699009 16:16248844-16248866 AAGAGGGAGGAGGGGGACTTCGG + Intronic
1134786066 16:16944734-16944756 AACCTGGAGGAGAGGACATTTGG + Intergenic
1134972828 16:18545829-18545851 AAGAGGGAGGAGGGGGACTTCGG - Intronic
1135465255 16:22679526-22679548 CAGAGGGTGGAGGGGAAATTAGG - Intergenic
1135603983 16:23807377-23807399 AAGAGAAAGGAGGGCACATTTGG - Intergenic
1135919785 16:26639236-26639258 GACATGGAGGAGTGGATATTTGG - Intergenic
1135966875 16:27042805-27042827 AACCTGGAGGATGGGACTTTAGG + Intergenic
1136398566 16:30005841-30005863 AACAGGGAGGAGGTCGGATTAGG - Exonic
1138161380 16:54758072-54758094 TTTAGGGAGGAGGTGACATTTGG + Intergenic
1139276707 16:65734576-65734598 CACAGGGAGTAGAGGACAGTAGG - Intergenic
1139280537 16:65766652-65766674 AAAAGAGAGGACTGGACATTTGG - Intergenic
1139750465 16:69106525-69106547 GAAAGGGAGGAGGGGTCAGTGGG - Intronic
1140722835 16:77786975-77786997 CTCATGGAGGAGGGAACATTTGG - Intergenic
1141092021 16:81136950-81136972 AACAGGCAGCAGGAGACATGTGG + Intergenic
1143311162 17:5990468-5990490 TAAAGGGAAGAGAGGACATTAGG + Intronic
1143457960 17:7079976-7079998 AGCAGGGAGAGGGGGACTTTGGG - Intronic
1143964186 17:10744919-10744941 GACAGGGAGGAGGGGAGAGAGGG + Intergenic
1144190734 17:12843135-12843157 AATAGGGCAGAAGGGACATTTGG - Intronic
1147243979 17:39108784-39108806 AAATGGGAGGAAGGCACATTTGG - Intronic
1147661452 17:42119190-42119212 AACAGGGAGGATGTGAACTTGGG + Intronic
1148035024 17:44653789-44653811 AACTGGGAGAAGGGGGCATGGGG + Intergenic
1148109570 17:45136962-45136984 AGCAGGGAGGAAGGGACAGGAGG + Intronic
1148989393 17:51652459-51652481 CAAAGAGAGGAAGGGACATTTGG - Intronic
1149355831 17:55838341-55838363 AATAGGGCAGAGGGGACAGTAGG - Intronic
1149362570 17:55910872-55910894 ATCAGAGAGGATGGGACAGTGGG + Intergenic
1150216945 17:63476522-63476544 AGGAGGGAGGCGGGGACCTTAGG - Intergenic
1151879514 17:76886654-76886676 ACCAGGGAGGAGGGGCCACCTGG + Intronic
1152073969 17:78147468-78147490 ACCAGGGAGGAGGGGACGCTGGG + Intronic
1153530262 18:6039013-6039035 AAGAGGGAGGAAGGGAGGTTGGG - Intronic
1153642745 18:7170334-7170356 CATAGGGAGGAGAGGATATTAGG - Intergenic
1153818224 18:8809472-8809494 AACATTGAGGAGGAGACTTTAGG + Intronic
1154268463 18:12898987-12899009 AACAGGAAGGAGAGGAAAATGGG + Intronic
1154371041 18:13763480-13763502 TCCAGGGAGCAGGGGACTTTAGG - Exonic
1156210345 18:34933337-34933359 TACAGGCAGAAGGGGAAATTGGG + Intergenic
1156233286 18:35175796-35175818 TTCAGGTAGGAGGGGACAATCGG - Intergenic
1156281377 18:35642739-35642761 ACCAGGGAAGAGGGGGCAATAGG - Intronic
1156465723 18:37346965-37346987 AACAGGGAGGAGGGGAAGAAGGG + Intronic
1157491877 18:48129276-48129298 AACCAGGAGATGGGGACATTGGG - Intronic
1158403420 18:57140920-57140942 AAGAAGGAGGAAGGGACATCTGG + Intergenic
1158536160 18:58309810-58309832 CAGAGGGAGGTGGGGACATCAGG + Intronic
1159930514 18:74308215-74308237 AACAGGGAGTAGGGGAAAAGTGG + Intergenic
1161591642 19:5131646-5131668 GGCAGGGAGGAGGGGACAGGAGG + Intronic
1163797775 19:19347254-19347276 GAATGGGAGGCGGGGACATTAGG - Intronic
1165181493 19:33975344-33975366 TACTGGGAGTAGGGGTCATTAGG + Intergenic
1166113829 19:40640676-40640698 AACTGGATGGAGGGGACACTGGG - Intergenic
1166326998 19:42057136-42057158 GACAGGGAGGAGGAGACAAGTGG + Intronic
1166875360 19:45893642-45893664 GACAGGGAAGATGGGAGATTGGG + Intronic
1167314626 19:48756423-48756445 ATCAGGGAGGATGGGACGGTGGG + Exonic
925053478 2:835568-835590 CAGAGGGAGGAAGGGAAATTTGG + Intergenic
926004781 2:9365327-9365349 ATCAGGGAGGAGCTGACCTTGGG + Intronic
926313952 2:11696151-11696173 AACTTGGAGGACGGGTCATTAGG - Intronic
926620527 2:15043020-15043042 AACAGGCAGTAGGTCACATTTGG + Intergenic
926833842 2:16996230-16996252 AAAAGCGAGGAGAGGGCATTAGG - Intergenic
926972033 2:18475898-18475920 AAAGGAGAGGAGGGGACATGGGG + Intergenic
927361685 2:22242682-22242704 AAAAGAGAGAAGGGGACACTAGG - Intergenic
927708401 2:25310999-25311021 ACCAGGGAGGAGAAGAGATTAGG + Intronic
928683570 2:33726921-33726943 AAAGGGGAGGAGGGGAGATAGGG + Intergenic
928899166 2:36299225-36299247 AGCTGGGAGTGGGGGACATTGGG + Intergenic
929674282 2:43909433-43909455 GACTGGGAGGAGGGGAAATGAGG + Intronic
929791212 2:45024458-45024480 GAGAGGCAGGAGGGGACACTGGG - Intergenic
930798226 2:55415355-55415377 TTCAGGGAGGAGGGCAAATTTGG - Intronic
931714109 2:65015165-65015187 AACTGTGAGGAGGGGAAAGTAGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
933678414 2:85078026-85078048 GACAGGGAGGAGGCAGCATTGGG + Intergenic
933783435 2:85818316-85818338 AACAGTGGGGAGGGGACATCTGG + Intergenic
934651517 2:96093790-96093812 CACAGGGAGGAGGGGGCCTTTGG + Intergenic
936025033 2:109025009-109025031 AGCTGGGAAGAGGGGACATAAGG - Intergenic
936883583 2:117282669-117282691 AACAGGAAGGAAGGAACTTTGGG - Intergenic
939044013 2:137228415-137228437 GACAGGGAGGATGGTAAATTTGG + Intronic
939166533 2:138646758-138646780 AATTGGGAGGAGGGTAAATTTGG + Intergenic
939864723 2:147460090-147460112 TACAGGAATGAGAGGACATTTGG - Intergenic
941833073 2:169983673-169983695 TACAGGGAGGAGTGGAGAATTGG + Intronic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
942147589 2:173041953-173041975 CACAGGGAGGAGGGGAGATCAGG - Intronic
943069701 2:183125976-183125998 GACAGGAAGGAGGGCACAATGGG - Intronic
943657247 2:190522602-190522624 AAAAGGGAGGAGGGCATAATGGG - Intronic
943690572 2:190865438-190865460 AACAGGGAGGAGTTGATATCTGG - Intergenic
944154490 2:196595169-196595191 ATCAGGGAGGAGGGGCCTATCGG + Intergenic
944950741 2:204745863-204745885 AACTGGGAGGATGGGGCTTTGGG - Intronic
945817910 2:214628024-214628046 AACTGGGGGGAGGGGAAAATGGG + Intergenic
1168890795 20:1294435-1294457 ACCATGGAGGAGGGGCGATTTGG - Intronic
1170354844 20:15480652-15480674 TACCAGGAGGATGGGACATTGGG + Intronic
1170540981 20:17387762-17387784 AACTGGGAGGCGGGGACAAGTGG + Intronic
1172185701 20:33029809-33029831 AAGAGGGAGGAAGGGACTTCTGG + Intergenic
1172250506 20:33475976-33475998 ACCTGGGAGGAGGGGGTATTGGG - Intergenic
1174266657 20:49336868-49336890 AACAGAAAGGAGGTGATATTTGG + Intergenic
1174306198 20:49615908-49615930 CACAGGGAGGAGGGCAGATTTGG - Intergenic
1174659443 20:52198403-52198425 AACAGGGAGGAGTGGGGACTGGG - Intronic
1175133711 20:56807879-56807901 AAGAGGGAGGAGATGACAGTCGG - Intergenic
1175212959 20:57373020-57373042 AACAGGGTGAAGGGGACGGTGGG - Intronic
1175345231 20:58268338-58268360 AGAAGAGAGGAGGGGGCATTTGG + Intergenic
1177225141 21:18244643-18244665 GACAGGGAGGAGGGGACCAGAGG + Intronic
1177447592 21:21217863-21217885 AACAGGATGGAGGTGACTTTGGG + Intronic
1177463389 21:21442354-21442376 AACATGGAGGATAGGACATAGGG + Intronic
1177926054 21:27217106-27217128 AAAAGAGAGGAAAGGACATTTGG + Intergenic
1178274653 21:31226140-31226162 GAAAGGGAGGAGGGGAGAGTGGG - Intronic
1178500896 21:33124798-33124820 ACCAGGAAGGAGGGTGCATTTGG - Intergenic
1180178789 21:46108048-46108070 AAGAGAAAGGAGGGGAGATTAGG - Intronic
1180969210 22:19806341-19806363 AGCGGTGAGGAGGGGACAGTGGG - Intronic
1181600262 22:23947702-23947724 CACAGAGAGAAGGAGACATTGGG + Intergenic
1181608243 22:23993618-23993640 CACAGAGAGAAGGAGACATTGGG - Intergenic
1181934031 22:26427360-26427382 AACAGGGAGGAGGTGAGTTCTGG + Intergenic
1183874152 22:40764666-40764688 ACAAGGGAGGAGGGGTGATTAGG - Intergenic
1184441994 22:44522758-44522780 AGCACAGAGGTGGGGACATTTGG - Intergenic
1184518660 22:44979218-44979240 TACAGGGAGGAGGTGCCATCTGG + Intronic
1184990947 22:48169585-48169607 AACAGGAAGGAGATCACATTGGG + Intergenic
949993140 3:9596007-9596029 CACTGGGAGGAGTGCACATTGGG + Intergenic
950193038 3:10991574-10991596 AGCAGGGAGGAGGCCAGATTAGG + Intergenic
950230660 3:11272740-11272762 AACACGGGAGATGGGACATTTGG + Intronic
950579654 3:13853941-13853963 AACAGGGAGGAGGGAGCAGCTGG + Intronic
951035243 3:17925555-17925577 AACAGGGAGGAGGCAAAATTTGG + Intronic
951186112 3:19715465-19715487 AAAAGGAAGGAGGGGTCATAGGG - Intergenic
952976443 3:38700278-38700300 AGCTGGGAGGAGGGGAAATTGGG + Intronic
953351222 3:42217730-42217752 AACAGGCATGAGGGGTTATTTGG - Intronic
953436885 3:42884527-42884549 AACAATGAGGAAGGGACCTTAGG + Intronic
954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG + Intronic
954536151 3:51360839-51360861 AACATGGAGGAGGGGGCATTTGG + Intronic
954578701 3:51691356-51691378 CACAGGGAGGAGGGCACTTTTGG + Intronic
955281607 3:57599507-57599529 TACAGGGAGGAGGGCTCATACGG - Intergenic
955352387 3:58203394-58203416 AAGACAGAGGAGGTGACATTGGG - Intronic
957933945 3:86918320-86918342 AACTGAGAGGTGGAGACATTAGG - Intergenic
958025800 3:88047583-88047605 AAGGGAGAGGAGGAGACATTAGG + Intergenic
958039736 3:88212425-88212447 AAATGGGAGGAGGGGATAGTAGG + Intergenic
958533732 3:95368020-95368042 AACAAGGAAAAGGGGACACTGGG - Intergenic
960052759 3:113253664-113253686 AAGGGGCATGAGGGGACATTGGG - Intronic
960070624 3:113426020-113426042 AACAGGTGGGAAGGCACATTTGG + Intronic
961445295 3:126977829-126977851 CACTGGGTGGAGAGGACATTGGG - Intergenic
961448191 3:126990933-126990955 AACAGGTGGGAGGGGGCAGTGGG - Intronic
963540958 3:146587640-146587662 AATAGGGAAGAGATGACATTAGG + Intronic
963858218 3:150278850-150278872 AACAAAGGGGAGGAGACATTCGG - Intergenic
965524614 3:169702585-169702607 AATTAGGAGGAAGGGACATTAGG - Intergenic
968946434 4:3666946-3666968 TCCAGGGAGGAGGGGACTTGAGG + Intergenic
969305917 4:6326260-6326282 AGCAGGGAGGAGCGGAGATGGGG + Intronic
970450764 4:16164956-16164978 AAGAGGGAGGAGAGGAGAGTTGG - Intronic
970565192 4:17325060-17325082 AAGAGGGAGGAGTCGGCATTTGG + Intergenic
971748098 4:30611193-30611215 AAAAGGGAGAAGGGGCCATGGGG + Intergenic
971783408 4:31068644-31068666 GACAGTTATGAGGGGACATTCGG - Intronic
973288599 4:48447188-48447210 AGCTGGGGGGAGGGGAAATTGGG - Intergenic
974555331 4:63439336-63439358 TACTGGGAAGAGGGGACATGTGG + Intergenic
976387152 4:84474184-84474206 CACAGGGTGCAGAGGACATTAGG - Intergenic
978832328 4:113102940-113102962 CACAGGGAGGAGGGGAGGTGAGG + Intronic
979164078 4:117504171-117504193 AACAAAGATGAGGGGAAATTGGG + Intergenic
982374385 4:154673583-154673605 AGCAGGGAGAAGGGGACAAGAGG + Intronic
983977604 4:173954138-173954160 AAAAGGGAGGAGGCATCATTTGG + Intergenic
985487233 5:158501-158523 CAGAGGGAGGAGGGGAGATAGGG - Intronic
985487279 5:158628-158650 CAGAGGGAGGAGGGGAGATGGGG - Intronic
985487322 5:158754-158776 CAGAGGGAGGAGGGGAGATGGGG - Intronic
986176640 5:5358217-5358239 GAAAGAGAGGAGAGGACATTCGG - Intergenic
986943262 5:12983103-12983125 AACAGGTGGCAGGTGACATTTGG + Intergenic
988728538 5:33947254-33947276 ACCAGGGTGGAGTAGACATTCGG + Exonic
990352587 5:54933772-54933794 AGCAGGGAGGAGGAGAGAGTAGG - Intergenic
993684032 5:90916071-90916093 GATAGGAAGGAGGGGATATTTGG + Intronic
994251679 5:97543184-97543206 AAAAGGAAGGAGGGATCATTTGG + Intergenic
994326480 5:98452625-98452647 AACAGGTATGAGGTGATATTTGG - Intergenic
995863178 5:116662615-116662637 CACAGGCAGGAGGGGAGATGAGG + Intergenic
997430414 5:133835193-133835215 AAGAGGCAGGCGGGAACATTGGG + Intergenic
997495861 5:134324926-134324948 AGTAGGGTGGAGGGGACATAAGG + Intronic
997611234 5:135217221-135217243 AACAGGGAGGAAGGGGAATGTGG - Intronic
997814085 5:136999379-136999401 GCCAGGGAGAAGGGGACAATGGG - Intronic
997863775 5:137443306-137443328 AAGAGGGAGGAGGAGACCTAAGG - Intronic
998968217 5:147563525-147563547 AGCAGGGAGGAGGAGAGTTTAGG + Intergenic
999768587 5:154757724-154757746 CATTTGGAGGAGGGGACATTTGG + Intronic
1001562596 5:172679056-172679078 GGCAGGGAGGCGGGGACATTAGG + Intronic
1002642363 5:180636309-180636331 ATAAGGCAGGAAGGGACATTCGG - Intronic
1003381607 6:5629514-5629536 AATAGGGAGGATGGGAGAGTTGG + Intronic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1007777334 6:44231020-44231042 AGCAGGGAGAGGGGGACAATAGG + Intronic
1007782722 6:44263654-44263676 AAGTGGGAGGAGGGGATACTGGG - Intronic
1007947393 6:45838564-45838586 AAACTGGAGGAGGGGGCATTTGG - Intergenic
1011582960 6:88891486-88891508 AAGAGGGAAGAGGTGAAATTTGG - Intronic
1011729083 6:90241998-90242020 AACGGGGAAGAGGGAACTTTTGG - Intronic
1012574941 6:100783217-100783239 AACACTGAGTAGGGGACATATGG - Intronic
1012677054 6:102128157-102128179 ACCAGGGAGTAGGAAACATTGGG + Intergenic
1013126188 6:107187047-107187069 AGCAGGGAGGAGTAGACTTTAGG + Intronic
1013209847 6:107977035-107977057 CAAAGTGAGGAAGGGACATTAGG - Intergenic
1013435642 6:110103152-110103174 AACAGGGAGCAGGTCAGATTTGG - Intronic
1014294863 6:119605786-119605808 ATCAGGAAGGTGGGGACTTTGGG - Intergenic
1014397022 6:120936844-120936866 AAGAGTGAGGAGAGAACATTTGG - Intergenic
1015082653 6:129246804-129246826 AACATGGAGGAGTGGACAGATGG + Intronic
1015773650 6:136792698-136792720 AAGAGGGAGGAGGGTCCTTTCGG - Intergenic
1016991785 6:149935193-149935215 CACAGGGAGGAGGGAATATCTGG - Intergenic
1017430900 6:154369807-154369829 AAGAGGGAGGTGGGAACATCAGG - Intronic
1018398761 6:163401891-163401913 AGCAGGGATGAGGAGAGATTGGG + Intergenic
1018735886 6:166686919-166686941 AACAGGGGTGAGGGGAGAATAGG + Intronic
1020471864 7:8546703-8546725 AGCAGGGAAGAGGGGTCACTGGG - Intronic
1020904910 7:14052816-14052838 CACTGGGAGGAGTGGACACTGGG - Intergenic
1021235056 7:18132853-18132875 AAGGGGGAGCAGGGCACATTGGG - Intronic
1021350432 7:19587218-19587240 AACAGAGGGGTGGGGATATTGGG - Intergenic
1022220758 7:28311441-28311463 AAGAGGGAAGAGAGGACAGTGGG - Intronic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1023764042 7:43494232-43494254 AAGAGGGAGGAGAGGAGATCAGG - Intronic
1024035297 7:45503045-45503067 CACTGGGAGGAGTGCACATTGGG - Intergenic
1024168102 7:46755003-46755025 GACAGGGTGGTGGGGACATAGGG - Intronic
1028441476 7:90867614-90867636 AATAAGGAGGAGGGGAAAATAGG + Intronic
1028565974 7:92231607-92231629 AAGACCGAGGAGGGGACACTGGG - Intronic
1029744874 7:102511307-102511329 ACCATGGAGGAAGGGACATCCGG + Intronic
1029762866 7:102610469-102610491 ACCATGGAGGAAGGGACATCCGG + Intronic
1031349037 7:120705914-120705936 TTCAGGGAGCTGGGGACATTAGG - Intronic
1032012708 7:128357368-128357390 ACCAGGGAGGAGGGGGAATGAGG + Intronic
1034139116 7:148800132-148800154 AACAGGGAACAGGGGACTGTGGG - Intronic
1034359669 7:150483199-150483221 AACTGGGAGGGGGGCAGATTGGG + Intergenic
1034379284 7:150675968-150675990 AACTGGGAGGGGGGAAGATTGGG + Intergenic
1034479325 7:151307675-151307697 AACAGGGAGATGTGAACATTTGG - Intergenic
1036567100 8:9946992-9947014 TACCAGGAGGCGGGGACATTTGG + Intergenic
1038272212 8:26084469-26084491 AACAGAAAGGAGGGCAGATTGGG + Intergenic
1038317745 8:26502041-26502063 AAGTGGGAGGAGGGCACTTTGGG + Intronic
1039062333 8:33581648-33581670 ACCCAGGAGGAGGGGGCATTCGG + Intergenic
1039983707 8:42429931-42429953 CACAGGGAGGAGGAGACAGTGGG - Intronic
1041158966 8:55018041-55018063 AACAGGGACATGGGGACACTGGG + Intergenic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1042818596 8:72905554-72905576 AGCAGGGTGGAGGGGTCACTCGG + Intronic
1047238082 8:123060189-123060211 ACCAAGGCGGAGGAGACATTAGG - Intronic
1047516593 8:125560269-125560291 AACAGGAAGGAAGAGAGATTAGG - Intergenic
1048372094 8:133787661-133787683 GACGTGGAGGAGGGGACATAAGG + Intergenic
1048592383 8:135832870-135832892 ACCAGGGAGGAAGGGACAGGGGG - Intergenic
1051261110 9:15265641-15265663 AAAAGGGAGGAGGGGAAAAAGGG + Intronic
1051320560 9:15900301-15900323 AAGAGGGCGGTGGGGGCATTTGG + Intronic
1051510205 9:17869043-17869065 AACAGGGAGCAGGGGTCTCTTGG - Intergenic
1051563708 9:18472067-18472089 AAGAGGGAGGAGGTGGTATTAGG + Intergenic
1051619989 9:19040809-19040831 AACAGGGAGAAGGGAACTTTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052069533 9:24065045-24065067 AACAGTGAGGACAGGACATTTGG - Intergenic
1052386554 9:27830005-27830027 CACAGGGAGAAGGGCACACTGGG - Intergenic
1053265878 9:36713123-36713145 AGCTGGGAGGAGGGGAGAATGGG - Intergenic
1055602350 9:77932943-77932965 AAAAGGGAGGAGATGACATAGGG + Intronic
1056436004 9:86576708-86576730 CACAGGCAGGAGGGGACAATGGG - Intergenic
1056904105 9:90630133-90630155 AACAGGAAGGCAGGGACTTTTGG + Intronic
1057211612 9:93203738-93203760 AAGAGGGAGGAAGGGACCGTGGG + Intronic
1057217494 9:93237110-93237132 AGCAGTGGGGAGGGGAGATTTGG + Intronic
1057766118 9:97920940-97920962 AACAGGGAGGTGGGAACCTTTGG - Intronic
1057873305 9:98734020-98734042 GTCAGGGAGGAGGGGTCAGTTGG - Exonic
1058581976 9:106468130-106468152 ACCAGGGAGGAAGAGACAGTTGG - Intergenic
1058674657 9:107389956-107389978 TGCAGGGAGGAGGAGACAATTGG + Intergenic
1059108736 9:111534662-111534684 AACAGGAAGGAGGGCAGATTGGG + Intronic
1059909099 9:119022575-119022597 AACAGGAAGGAGGTCAGATTTGG - Intergenic
1060495911 9:124118500-124118522 AGCAGGGAAGAGGGTAGATTTGG - Intergenic
1060781593 9:126417058-126417080 CACAGGAAGCAGGGGACATGGGG - Intronic
1062032849 9:134369812-134369834 AACTAGGAGGAGGGGACCTCTGG - Intronic
1062082909 9:134633910-134633932 AACAGGGAGGAGGTGGCCTGGGG - Intergenic
1062467942 9:136689465-136689487 AAGAGGGAGGAGGTGAAATTAGG - Intergenic
1186846153 X:13533075-13533097 AACAGGAAGCAGGACACATTTGG - Intergenic
1186999338 X:15159091-15159113 AGTAGGGACCAGGGGACATTTGG + Intergenic
1187724498 X:22188482-22188504 AACAGGCAGCAGGTGAGATTTGG - Intronic
1189299583 X:39942808-39942830 AGCAAGGAGGAAGGGACATGTGG + Intergenic
1190113003 X:47607123-47607145 AACAGGTAAGTTGGGACATTTGG - Exonic
1190133667 X:47774260-47774282 CACAGGGAGGAGGGAAAAATTGG - Intergenic
1190360311 X:49643142-49643164 AAAAGGGAGGAGGGCATAATGGG - Intergenic
1190735260 X:53251464-53251486 ATCAGGGAGGAGGTAACGTTTGG - Intronic
1190937134 X:55007382-55007404 CACCGGGAGGAGGGGTCAGTGGG - Exonic
1191712237 X:64162418-64162440 AGTAGGGAGGAGGGGAGAATGGG - Intergenic
1194885156 X:99305774-99305796 AGCAGGGAGTAGGTGATATTTGG + Intergenic
1195255113 X:103082476-103082498 AAGGGGGAGGAGGGTTCATTAGG - Intronic
1196036095 X:111146932-111146954 AGCAGAGAGGAGGGAATATTTGG - Intronic
1196531494 X:116792179-116792201 AACTGGTAGCAGGGAACATTTGG - Intergenic
1198558014 X:137816644-137816666 GAAAGTGAGGAGGGGACAATGGG - Intergenic
1199828747 X:151527852-151527874 ATCAGGGAGGAGGGGGTATTGGG - Intergenic
1201629691 Y:16056697-16056719 GAAAGGGAGGAGGGGACATGGGG - Intergenic