ID: 1065248820

View in Genome Browser
Species Human (GRCh38)
Location 10:23788341-23788363
Sequence GAGAACTCCTTGGCAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065248820_1065248830 21 Left 1065248820 10:23788341-23788363 CCTTTATTTGCCAAGGAGTTCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1065248830 10:23788385-23788407 CAAGGTTACTCAGCCTCTTGGGG No data
1065248820_1065248827 19 Left 1065248820 10:23788341-23788363 CCTTTATTTGCCAAGGAGTTCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1065248827 10:23788383-23788405 CCCAAGGTTACTCAGCCTCTTGG No data
1065248820_1065248829 20 Left 1065248820 10:23788341-23788363 CCTTTATTTGCCAAGGAGTTCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1065248829 10:23788384-23788406 CCAAGGTTACTCAGCCTCTTGGG No data
1065248820_1065248825 3 Left 1065248820 10:23788341-23788363 CCTTTATTTGCCAAGGAGTTCTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1065248825 10:23788367-23788389 GGGAGGAAGTAAGTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065248820 Original CRISPR GAGAACTCCTTGGCAAATAA AGG (reversed) Intronic
902822208 1:18950310-18950332 GAGAAATCCTTGTAAATTAAAGG + Intronic
902998174 1:20243777-20243799 GAACACTTCTTGGCAATTAAGGG - Intergenic
905000495 1:34664427-34664449 GAGAACTCATGGGCACAAAAAGG - Intergenic
909210116 1:72812648-72812670 GTGAAATTCTTGGTAAATAAAGG + Intergenic
911055693 1:93706409-93706431 AAGACTTCCCTGGCAAATAAGGG - Intronic
913243585 1:116851932-116851954 GACACCTCCTGGGCAATTAAGGG + Intergenic
916367555 1:164049316-164049338 TAAAACTCCTCAGCAAATAAGGG - Intergenic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
918017771 1:180653489-180653511 GAGAAATACTTGGCAATTATTGG + Intronic
919502861 1:198359817-198359839 GAGAACTTAATGGCAAAGAATGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
923630540 1:235646781-235646803 AAGAACTCCTTGGCAATTAGAGG + Intronic
923887735 1:238177542-238177564 GAGTACTCTTTGGCAATTGAGGG + Intergenic
1063512529 10:6660043-6660065 GGGAACTTCTAGGCAAATGACGG + Intergenic
1064914427 10:20441010-20441032 GAGAACTACGTGACAAAGAAAGG - Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1069402056 10:68058746-68058768 GAGAACACCTAGGCACAGAAAGG + Intronic
1069759744 10:70800561-70800583 GAGTACTCTTTGGCAATTGAGGG - Intergenic
1071378195 10:85032031-85032053 GAGATCTCCTTGGGAAAGGATGG - Intergenic
1074070030 10:110058194-110058216 GAGATTTCTTTTGCAAATAAAGG + Intronic
1078119130 11:8488536-8488558 TAGAGTTCCTTGGCAAAGAATGG + Intronic
1080969877 11:37260123-37260145 CAGAACTTCTTGACAAATTAGGG - Intergenic
1082700799 11:56427857-56427879 GATAACTCCTAGCCTAATAAGGG + Intergenic
1083094620 11:60237138-60237160 GAGAACACATGGGCACATAAAGG - Intronic
1084587351 11:70070305-70070327 GCGAACTCCTCTGCAGATAAGGG + Intergenic
1087651577 11:100874581-100874603 GTGAACTCCATGGAAAATACGGG - Intronic
1088286748 11:108198048-108198070 CAGACCCCCTTGGCAAACAATGG + Intronic
1097386241 12:58952862-58952884 AAGACCTCCTTGGGAGATAATGG + Intergenic
1097968950 12:65611568-65611590 GAGAATTCATTGGCTAATACTGG + Intergenic
1098730862 12:74035937-74035959 GAGATCTCCTTGGGGAAGAATGG - Intergenic
1101598307 12:106187170-106187192 GCGAATTCCTTGGAAATTAATGG - Intergenic
1101810182 12:108101222-108101244 GAGATCTCTTTGTCAAATATGGG + Intergenic
1101937265 12:109068431-109068453 GAGAACACCTTTAAAAATAAGGG - Intronic
1102830539 12:115994729-115994751 TAGAACACCTTGGCGCATAAGGG - Intronic
1104219301 12:126766750-126766772 GAGAAATCCTAGGCAGACAAGGG + Intergenic
1104266825 12:127241166-127241188 GTGGACACCTTGACAAATAAAGG - Intergenic
1104422991 12:128652412-128652434 AAGAACTCCTGTGCTAATAAAGG + Intronic
1105647118 13:22332971-22332993 GAGGCCTCCTTGCCAAACAATGG + Intergenic
1105821338 13:24083686-24083708 GAGGATTGCTTGGCAAATCAAGG + Intronic
1108634147 13:52315832-52315854 GAGAATCCCTGGGCAAAGAATGG - Intergenic
1111695916 13:91623502-91623524 GAGAACTCCATGGGAAGCAATGG + Intronic
1112115423 13:96346960-96346982 GAGGTCCCCATGGCAAATAATGG + Intronic
1117272051 14:54154674-54154696 GAGAACTCATGGACAAAAAAGGG - Intergenic
1117541910 14:56755702-56755724 AAGGACTCTTAGGCAAATAAAGG + Intergenic
1119078888 14:71673381-71673403 GAGAAATTCTTAGAAAATAATGG - Intronic
1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG + Intronic
1120327638 14:83050616-83050638 GAGAATTCCATGGCAAGTCAGGG + Intergenic
1121747720 14:96313132-96313154 GAGATCGGATTGGCAAATAAAGG + Exonic
1126946995 15:53832499-53832521 TAGAAGTCCCTGGCAAATGAGGG + Intergenic
1127449873 15:59105668-59105690 TACAACTCCTTGCCAACTAAGGG + Intronic
1138976225 16:62211652-62211674 AAGAAATCCTTTGAAAATAATGG - Intergenic
1139581202 16:67874729-67874751 AAGAGCTGCTTGGCAAACAAGGG - Intronic
1140862472 16:79030411-79030433 GAGAACACTTTGGGAAAAAAGGG - Intronic
1145046424 17:19621001-19621023 GAGAGTCCCTTGGCAAAGAATGG - Intergenic
1146566210 17:33915271-33915293 GAGAAGCCCCTGGCAAATGATGG - Intronic
1148041076 17:44707879-44707901 GAGATCTCCTAGGGAGATAAGGG + Intergenic
1152669860 17:81596802-81596824 AAGAACTTCTTGAAAAATAATGG + Intronic
1152822950 17:82446422-82446444 GGGAATTCCTTGGCCAAGAACGG + Intronic
1153791118 18:8580681-8580703 CAGAACTCTTAGGTAAATAATGG + Intergenic
1156506739 18:37600656-37600678 AAGAACTACTAGGCAAATTAGGG - Intergenic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1160167147 18:76523797-76523819 GAGGACTATTTGGCAAATATTGG + Intergenic
1160396962 18:78579827-78579849 GAGAACCCCTTGGCAAACTAGGG - Intergenic
1164660921 19:29966529-29966551 GTAAACCCCTTTGCAAATAAGGG - Intronic
925733097 2:6936524-6936546 GATGACTCCTTGTTAAATAAAGG - Intronic
929133902 2:38604063-38604085 GAGTAGTCCTTGGGAAATAAAGG + Intergenic
931559620 2:63545771-63545793 CACACCTCCTTGGCAAAAAACGG + Intronic
933467509 2:82673460-82673482 GAGAACTCATTGGCAGATGCGGG - Intergenic
933875053 2:86611836-86611858 GAGATCTCTTTGGAAAAGAAAGG + Intronic
937720522 2:125090107-125090129 GAGAAGCCCTTGACAAATCATGG + Intergenic
940495764 2:154426263-154426285 GAGAGCTACATGGCACATAACGG - Intronic
942304640 2:174594340-174594362 GAGTACTGCTAGGGAAATAAAGG + Intronic
943003090 2:182354544-182354566 CAGAACAACTTGGCAGATAAGGG + Intronic
943555683 2:189401255-189401277 GAGAACACCTGGACACATAAGGG - Intergenic
945451919 2:210003630-210003652 GAGAACTACTTGGCAAACCTAGG - Intronic
945560263 2:211330651-211330673 GACAACTCCTAGGCAGATCAGGG - Intergenic
946764517 2:223027656-223027678 GAGAACTCCTTGGCAGGCATAGG + Intergenic
948881331 2:240858810-240858832 GAGTACTCTTTGGCAATTGAAGG + Intergenic
1169563682 20:6829276-6829298 GAGAACTCTTTAACAAACAAGGG - Intergenic
1170366232 20:15601203-15601225 GACAGCTCCTTTGCCAATAAGGG - Intronic
1171756840 20:29118459-29118481 GAAAATTCCTTGGTAAATATGGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174082720 20:47982588-47982610 GAGAACAACTGGGCAAAAAATGG - Intergenic
1178036687 21:28591741-28591763 GAGAACTCATGGGCAAATATAGG - Intergenic
949204069 3:1417074-1417096 GAGAAGTGCTGGGCAAAGAAGGG + Intergenic
950605642 3:14077339-14077361 GAGAAAACCTTGGTAAGTAAGGG + Intronic
952157140 3:30655699-30655721 CAGCACTACTTGGCCAATAATGG - Intronic
953378221 3:42446709-42446731 GAGATCCCCTTGGCCAAGAAGGG + Intergenic
955719239 3:61864263-61864285 TAGAAATCCTGGGTAAATAAGGG - Intronic
955886488 3:63604588-63604610 GATAACTTCTAGGTAAATAATGG - Intronic
957467693 3:80616194-80616216 GAGAACACATTGGCACATAGAGG + Intergenic
962711206 3:138087776-138087798 GATAATTCCATGGCAAAGAAGGG - Intronic
963611253 3:147471775-147471797 GAGATATCCCTGGCTAATAATGG + Intronic
963993833 3:151684227-151684249 GAGAACTCATTGCCACAAAATGG + Intergenic
964914408 3:161822579-161822601 GCAAACTCCTTTGAAAATAAAGG + Intergenic
966132337 3:176655385-176655407 GAAAAATCGTTGGCAAATTATGG + Intergenic
966622861 3:181984562-181984584 GAGAGCTCCTTTGCAAAAAGGGG + Intergenic
968183255 3:196612769-196612791 CATAACTCCTTGGCAAGGAAAGG - Intergenic
970952102 4:21768528-21768550 GAGAAATCCTTTGTAAACAAAGG - Intronic
976362585 4:84197142-84197164 GAGAATCCATTGGCCAATAATGG + Intergenic
978320623 4:107490759-107490781 GAGAACACATGGGCAAATAGAGG + Intergenic
978489214 4:109293381-109293403 GTGAACTCTTTGGTAAACAAGGG + Intronic
979324779 4:119366151-119366173 GAGAACTCTATAGCAAATTAGGG - Intergenic
979341079 4:119525029-119525051 GTGAACTCCTTTGAAAATGAAGG - Intronic
979725467 4:123955797-123955819 GAGAAATCCTAGGCAAACAGGGG + Intergenic
979738760 4:124123189-124123211 GAAAACTCATTGGCAAGTGAGGG + Intergenic
979939592 4:126743664-126743686 CAGGGCTCCTTGGCAACTAATGG + Intergenic
983242625 4:165250850-165250872 GAGAACTCTATAGCAAATTAGGG - Intronic
985879272 5:2626386-2626408 AAGAACTCCTGGGAAAATAACGG + Intergenic
987639402 5:20593174-20593196 GAGAACTCCAGGGCAAATCAAGG + Intergenic
988338246 5:29934675-29934697 TAGTTATCCTTGGCAAATAAAGG - Intergenic
991624704 5:68588279-68588301 AAGATCTTCTTGGCAAATAATGG - Intergenic
992554718 5:77892144-77892166 GGAAAGTCCTTGGCAAACAATGG + Intergenic
993319483 5:86455874-86455896 GAGCACTGATTGGCAAAGAATGG + Intergenic
993521336 5:88905640-88905662 AAAAATTCCTTGGAAAATAATGG + Intergenic
993744270 5:91576797-91576819 GAGAACACCTGGGCACATAGAGG + Intergenic
993835754 5:92818230-92818252 GAGAAGGCCTTGGAAAATAAAGG - Intergenic
997001518 5:129767582-129767604 ATGCAATCCTTGGCAAATAACGG + Intergenic
998137753 5:139683178-139683200 GAGACTTCCTGGGCAAAGAATGG + Exonic
999030373 5:148284045-148284067 CAGATCTCCTTGGCAAAAATGGG + Intronic
1000685129 5:164238966-164238988 CAGAGCTCCTCAGCAAATAATGG + Intergenic
1004112280 6:12730793-12730815 GAGAACACATGGGCACATAAAGG - Intronic
1010818225 6:80385377-80385399 GAGCACTGATTGGAAAATAATGG + Intergenic
1011918712 6:92544132-92544154 GAGAACACTTTGGCAAATCATGG + Intergenic
1013578815 6:111511604-111511626 GAAAACTCCTAGGAAAATATTGG + Intergenic
1016297361 6:142587549-142587571 GAGAACTCCTTTGGAACAAATGG + Intergenic
1017955028 6:159170037-159170059 GAGAAATTCTGGGCAAAGAAAGG - Intronic
1024944374 7:54794146-54794168 GAGAACTCATGGGCACATAGAGG + Intergenic
1026094621 7:67334366-67334388 AAAAATTCCTTGGAAAATAATGG - Intergenic
1026860859 7:73787590-73787612 GTGAAAACCTTGGCAAGTAAGGG - Intergenic
1027192093 7:76002611-76002633 GACATCTACTGGGCAAATAAAGG + Intronic
1027405679 7:77857412-77857434 GAGAATTCCTTAGCGGATAATGG - Intronic
1027429384 7:78094626-78094648 GTGATATCCTTGGAAAATAAAGG - Intronic
1027851554 7:83459346-83459368 GAAAATTCCTTTGAAAATAAAGG + Intronic
1028259608 7:88645743-88645765 GAGAACTCCATGTAAAATGAAGG + Intergenic
1029239748 7:99151248-99151270 GAGAAGTCCTAGGCAGATAGAGG - Intergenic
1030747328 7:113182915-113182937 AAGAACTCATTGGCAATCAACGG - Intergenic
1031342997 7:120628683-120628705 TAGAATTCCTAGGCACATAAGGG - Intronic
1033374896 7:140749875-140749897 GAGGACACCTTAGAAAATAATGG + Intronic
1038443852 8:27589460-27589482 GGGAGCTCCTTGGCAAATGTTGG + Intergenic
1040096131 8:43444850-43444872 GAGAACAGCCTGGCCAATAATGG + Intergenic
1042081515 8:65059578-65059600 GAGAAATCCTAGGCAGAAAAGGG + Intergenic
1043269617 8:78315126-78315148 GAGAACTCATGGACAAATAGAGG - Intergenic
1043882786 8:85564239-85564261 GGCATCTCCTTGGCAAAGAAAGG + Intergenic
1043944978 8:86239371-86239393 GAGAGCTCTTTGGTAAACAATGG + Intronic
1044801859 8:95965120-95965142 GGGAACTCAGTGGCATATAAGGG + Intergenic
1045678865 8:104637387-104637409 GAGAGCCCCTCGGCAAATCACGG + Intronic
1046340696 8:112851187-112851209 GAGATCTTCTTGGCAAATGAAGG + Intronic
1047334000 8:123919111-123919133 GAGAACTCCTTGGGAAGGAAGGG + Intronic
1050339047 9:4617412-4617434 GAGTGCTGTTTGGCAAATAAAGG + Intronic
1058310735 9:103498660-103498682 GAAAACTGCTTGGCAAACATAGG - Intergenic
1059016753 9:110526113-110526135 AAGAACTCTTTGGCTAATACTGG - Intronic
1060518381 9:124279950-124279972 AAGAAATGCTTGGCAAATGATGG + Intronic
1061327778 9:129874675-129874697 GTGCACTCCTTGGCAAGGAAGGG - Exonic
1185662529 X:1738681-1738703 GAGAACCCCTTGGCCAACAGGGG + Intergenic
1188794584 X:34446079-34446101 GAGAACACATGGGCACATAAAGG + Intergenic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1193013634 X:76707075-76707097 GAGAACACATGGGCACATAAGGG + Intergenic
1193707474 X:84839823-84839845 GAGAACACCTTGGCATATAGAGG + Intergenic
1194403355 X:93464499-93464521 GAGAACTGCTTTGTAAAAAAAGG + Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1195281443 X:103338495-103338517 GAGAACCCCTTGGTAAAGTAGGG - Intergenic
1198844678 X:140898209-140898231 GTGAAAACCTTGGCAAGTAAGGG + Intergenic
1200815066 Y:7522673-7522695 GAGAACTCCTGGACACATAGAGG + Intergenic
1201309456 Y:12582896-12582918 GAGAACACCTGGGCACATAGAGG + Intergenic
1201673688 Y:16555086-16555108 GAGAACTCTCTGGCTTATAAAGG - Intergenic