ID: 1065253714

View in Genome Browser
Species Human (GRCh38)
Location 10:23843555-23843577
Sequence AGTGGATCTGGAGGGACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 15, 3: 55, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065253714_1065253722 12 Left 1065253714 10:23843555-23843577 CCATTGGTCCCTCCAGATCCACT 0: 1
1: 0
2: 15
3: 55
4: 275
Right 1065253722 10:23843590-23843612 ATTCTGCTCTCTACTTGGAATGG No data
1065253714_1065253720 7 Left 1065253714 10:23843555-23843577 CCATTGGTCCCTCCAGATCCACT 0: 1
1: 0
2: 15
3: 55
4: 275
Right 1065253720 10:23843585-23843607 TCCTAATTCTGCTCTCTACTTGG No data
1065253714_1065253723 26 Left 1065253714 10:23843555-23843577 CCATTGGTCCCTCCAGATCCACT 0: 1
1: 0
2: 15
3: 55
4: 275
Right 1065253723 10:23843604-23843626 TTGGAATGGCTAATTTCAGTTGG No data
1065253714_1065253724 27 Left 1065253714 10:23843555-23843577 CCATTGGTCCCTCCAGATCCACT 0: 1
1: 0
2: 15
3: 55
4: 275
Right 1065253724 10:23843605-23843627 TGGAATGGCTAATTTCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065253714 Original CRISPR AGTGGATCTGGAGGGACCAA TGG (reversed) Intronic
901726025 1:11242754-11242776 ACTGGAACTGAAGGGACCTAAGG - Intronic
903254220 1:22082109-22082131 AGTGGTTGGGGAGGGACTAAGGG + Intronic
903310237 1:22449809-22449831 AGTGGAACAGGAGGGACAGATGG + Intergenic
903678312 1:25080494-25080516 AGTGAAACTGGAGAGACCAGTGG - Intergenic
904171160 1:28592861-28592883 AGTGGACCGGGCGGGACCCAGGG - Intronic
904849701 1:33447995-33448017 AGTGGGTCTGGAGGGGCAAATGG + Intergenic
904899890 1:33848532-33848554 AGAGGATCTGGAGGTGCAAATGG + Intronic
904998814 1:34652175-34652197 TGGGGATCTGAAGGGACCTATGG + Intergenic
905199631 1:36307063-36307085 GGCGGGGCTGGAGGGACCAAAGG + Intronic
905262805 1:36731343-36731365 ACAGGACCTGGAGGGACGAATGG - Intergenic
905697798 1:39988296-39988318 AGTGGATCTGGAGGGGCAAATGG + Intergenic
906717409 1:47980421-47980443 AGGTGATCTGGAGGGTCCTATGG - Intronic
906882844 1:49611296-49611318 AATGGATCTAGAGGGACAAATGG + Intronic
906892379 1:49730934-49730956 AATGGCTCTGGAGGGACAAATGG - Intronic
907662882 1:56409408-56409430 AGTGGAGGTGGAGGCACAAACGG - Intergenic
908356691 1:63329783-63329805 AGTGGTTCTGCGGGGACCGACGG + Intergenic
909349686 1:74637068-74637090 GGTAGATCTAGAGGGACAAATGG - Intronic
914809057 1:151013311-151013333 CTTGGAACTGGAGTGACCAAGGG - Intronic
917099715 1:171432753-171432775 TTTGTATCTGTAGGGACCAAGGG - Intergenic
917371492 1:174298517-174298539 ATTGGATCTGAAGGATCCAAAGG - Intronic
918422386 1:184377161-184377183 AGTGGATTTTGAGGGAACATGGG + Intergenic
919907847 1:202090259-202090281 AGTTGGGCTGGTGGGACCAAGGG + Intergenic
921591665 1:217011443-217011465 ACTGGCTCTGGAGGGAACAGAGG + Intronic
921858250 1:220012715-220012737 AGTGGAGGTGGAAGGACCAGAGG + Intronic
922793233 1:228322166-228322188 AATGGCTCTGGAGGCACCACAGG - Exonic
923016401 1:230129861-230129883 ATTGGATCTGAAAGGACCACAGG + Intronic
924037410 1:239951091-239951113 AGTGAATCTGAGGGGACAAACGG + Intergenic
1064143279 10:12807781-12807803 AGTGGAGCTGGACGGAGGAACGG - Intronic
1065253714 10:23843555-23843577 AGTGGATCTGGAGGGACCAATGG - Intronic
1065734252 10:28737062-28737084 AGTTGGGCTGGTGGGACCAAAGG + Intergenic
1065763096 10:29001560-29001582 TGAGGGTCTGGAGGGACCAGAGG - Intergenic
1066996956 10:42572742-42572764 AGTAGATCTTCAGGGATCAAGGG + Intergenic
1067698510 10:48552443-48552465 AGTGCATCTGGGGGGACAAGGGG - Intronic
1067849633 10:49746538-49746560 AGTAGGGCTGGAAGGACCAAAGG - Intronic
1069274252 10:66569203-66569225 AGGGGATGTGGAGGGACAAATGG + Intronic
1069717219 10:70529081-70529103 AGTGGATATTGAGGGACAATGGG + Intronic
1072108890 10:92299141-92299163 AGTGGATCTGGAAGGAAAGAAGG - Intronic
1072806799 10:98428671-98428693 AGATGATGTGGAGGGACCACAGG + Intronic
1073438789 10:103539560-103539582 AGTTCAGCTGGAGGGAGCAAAGG + Intronic
1073711456 10:106047556-106047578 AGTGGATCTAGAGGGACAAATGG - Intergenic
1074506147 10:114072511-114072533 AGTGGATCTGGAGGGATAGAGGG - Intergenic
1074824197 10:117202747-117202769 AGTGGGTCTGCAGGGAAGAAAGG + Intronic
1075399594 10:122151453-122151475 AGAGGAACTGGAGGGACTAGAGG + Intronic
1075462184 10:122624192-122624214 CATGGATCTGCAGGGACCACTGG - Intronic
1075767196 10:124903095-124903117 AATGGATCTGGAAGGACAAATGG - Intergenic
1078108612 11:8374077-8374099 ACTGGATTTGGAGGCAGCAAGGG - Intergenic
1078564455 11:12402395-12402417 AGTGGATCTGGAGGGGCAAGTGG + Intronic
1078810466 11:14756647-14756669 AGTGGATCTGAAGGGACAAATGG + Intronic
1081577792 11:44330035-44330057 AGGGGACCTGCAGGGACCACAGG + Intergenic
1083997278 11:66278589-66278611 CGCGGAGCTGGAGGGACCCAGGG + Intronic
1084458035 11:69279693-69279715 AGTGACTCTGAAGGGACCCATGG - Intergenic
1085341160 11:75732441-75732463 AGTGGATCTGGAGGGGTCAACGG + Intronic
1085466864 11:76730003-76730025 AGTGGATCTGGACGGGCAAAGGG + Intergenic
1085505075 11:77053965-77053987 AGTCAGGCTGGAGGGACCAAGGG - Intergenic
1086053025 11:82616411-82616433 AGTGAATCTGCAGAGGCCAATGG - Intergenic
1086207134 11:84272790-84272812 AGTAGCTCTGGGGGAACCAATGG + Intronic
1086279580 11:85170872-85170894 AGTTGGGCTGGTGGGACCAAGGG - Intronic
1087256836 11:95965420-95965442 AGTGGATCTGAAGGGTGCAACGG - Intergenic
1088577695 11:111287604-111287626 ATTGGATCAGGAGGGACCAGAGG - Intergenic
1089123523 11:116159972-116159994 AGTGGCTCAGGAGGGGCCAATGG + Intergenic
1089157900 11:116416078-116416100 AGTGGGACTGCAGGGACCCAGGG - Intergenic
1089197371 11:116702106-116702128 TGTGGGTCTGGAGGGGCCAGAGG - Intergenic
1090350267 11:126103639-126103661 AGTGCGTCTGGAGGGACAGAAGG - Intergenic
1091007470 11:131966626-131966648 AGTGGACCTGGAGTGTCCATGGG + Intronic
1093471370 12:19505615-19505637 AGCGTAGCTGGAGGGAACAAGGG + Intronic
1093779820 12:23122159-23122181 TGTAAATCTGGAGGTACCAAGGG - Intergenic
1094596820 12:31873491-31873513 AGAGGGTGTGGAGGGACAAAAGG + Intergenic
1094840452 12:34340604-34340626 AGGGGATGTCGAGGCACCAAAGG + Intergenic
1095392803 12:41728880-41728902 AGTGGATCTGGAAAGGCAAATGG + Intergenic
1098350034 12:69548970-69548992 AGTGGCTTTGGAGGGTCAAATGG + Intronic
1100083081 12:90876422-90876444 ATTGGATCTGGAGGTAGCAGGGG + Intergenic
1100229559 12:92593326-92593348 AGTGGACCTGGAGAAACCAACGG + Intergenic
1101791699 12:107933547-107933569 AGTGGATGTGGAAGGGCAAACGG + Intergenic
1102625576 12:114233001-114233023 AGTGGATCTGGAGGAGTAAATGG - Intergenic
1102699911 12:114830060-114830082 AGTGGATCTAGAGAGCCAAACGG + Intergenic
1102816395 12:115869612-115869634 AGTGAATCTGGAGGGGAAAATGG + Intergenic
1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG + Intronic
1103237436 12:119385168-119385190 AGTGGTTCTGGAGAGGCAAATGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104952928 12:132450558-132450580 GGTGGGCCTGGAGTGACCAAGGG + Intergenic
1105572919 13:21621003-21621025 GGAGGAGCTGGAAGGACCAAGGG - Intergenic
1106121769 13:26865665-26865687 ACTGGAGCAGGAGGGAGCAAGGG - Intergenic
1107278683 13:38708029-38708051 TGTGGTTCTGAAGGAACCAATGG - Intronic
1111708259 13:91778601-91778623 AGTTGATCTGGAAGGACACAGGG - Intronic
1113972972 13:114204395-114204417 AGTCAAGCTGGTGGGACCAAGGG - Intergenic
1114376189 14:22148923-22148945 AGTCGATATAGAGGGACAAATGG + Intergenic
1115087922 14:29539348-29539370 AGTGGATCTGGAAGGACAAATGG + Intergenic
1116452271 14:45080132-45080154 TGTTGATCTGGAGGGGCAAATGG + Intergenic
1116992380 14:51290034-51290056 AATGGATTTGGAGGGGCAAAGGG + Intergenic
1119159255 14:72439626-72439648 AGTGGCTCTGGAGGGACAAGTGG - Intronic
1119198335 14:72733701-72733723 CATGGATCTGGAGGGGCAAATGG + Intronic
1119205484 14:72790859-72790881 AGAGAATCTGGAGGGACCAATGG - Intronic
1119228115 14:72959737-72959759 AGTGGGTCTGGAGGGGCCCAGGG - Intergenic
1119463235 14:74829679-74829701 ATGGGATGTGGAGGGTCCAAAGG + Intronic
1119898659 14:78242213-78242235 AGTGGCTCTGGAAGAACCCACGG + Intergenic
1123971829 15:25514805-25514827 AGGGGATCCGAGGGGACCAAGGG + Intergenic
1124144130 15:27105876-27105898 AGTGTATATGGATGGACAAATGG + Intronic
1124341090 15:28889466-28889488 CGTGGATGTGGAGGGAGCACTGG - Intronic
1124830893 15:33148400-33148422 AGTGGATCTGGAGGAGCCAATGG - Intronic
1125006634 15:34824282-34824304 AGTGTGTCTGCAGGGACAAATGG + Intergenic
1125023350 15:35006398-35006420 AATAGATCTAGAGGGGCCAAAGG + Intergenic
1126179669 15:45772958-45772980 AGCGGATCTGGAAGGACGAAGGG - Intergenic
1126183307 15:45807006-45807028 AGTGGATGTGGAGGGGCAATTGG + Intergenic
1126347215 15:47708968-47708990 AGTAGATCTGGTGGCACAAATGG - Intronic
1126796556 15:52264693-52264715 AGAGAATCTGGAGGGGCAAACGG - Intronic
1129121508 15:73399808-73399830 AATGGATATAGAAGGACCAAAGG + Intergenic
1129202665 15:74014144-74014166 ATTGGAGCTGGAGAGACCAGAGG + Intronic
1130016727 15:80193207-80193229 AATAGATCTGGAGGGACAAAGGG - Intergenic
1130102977 15:80907921-80907943 AGTGGAACTGAAGAGACAAATGG + Intronic
1131359031 15:91772837-91772859 ACTGGATTTCGAGGGGCCAAGGG - Intergenic
1131424147 15:92331854-92331876 ATTGGGTCTGGAGGGACAAATGG - Intergenic
1131690706 15:94824412-94824434 AGTGGGTCTGGAGTGACAAGTGG + Intergenic
1132062707 15:98705628-98705650 AGAGGAAGTGGAGGGACCCAAGG - Intronic
1133439128 16:5805916-5805938 AGTGGATCTGGGGGGACAAATGG + Intergenic
1133987267 16:10677909-10677931 AATGGATCTGGGGAGATCAATGG + Intronic
1134365508 16:13574018-13574040 ACTGGACATGCAGGGACCAAAGG - Intergenic
1135017603 16:18936813-18936835 AATAGATTTGCAGGGACCAATGG - Intergenic
1135473273 16:22751261-22751283 AGGAGATCTGGTGGGACAAATGG + Intergenic
1136477055 16:30520018-30520040 AGGGGATCTGGTGGGAGCCAGGG + Intronic
1137628912 16:49928338-49928360 TGGGGATGTGGAGGGCCCAAGGG - Intergenic
1137637965 16:50003640-50003662 AGTGGATATGGAAGAACAAAGGG + Intergenic
1139330489 16:66185317-66185339 ATTGGATCTGGAATAACCAAGGG - Intergenic
1140121961 16:72091489-72091511 AATGGCTGTGGAGGGACCAATGG + Intronic
1140941660 16:79726756-79726778 AGTGAGTCTGGAGGGACAGATGG + Intergenic
1141261981 16:82462537-82462559 AGTGGTTCTGCAGGGGCCAGTGG + Intergenic
1141314909 16:82952725-82952747 AGTGGACCTGGAGGGGCCAGTGG - Intronic
1141388865 16:83647777-83647799 AGTGGTGCTGGTAGGACCAAAGG + Intronic
1141852028 16:86652989-86653011 AGAGGGTCTGGAGGGAAGAAGGG - Intergenic
1143469714 17:7165005-7165027 TGTGGATCTGGAAGGACAAATGG - Intergenic
1145119839 17:20248230-20248252 AGAGGATCTGGAAGGTGCAAGGG - Intronic
1145202515 17:20959324-20959346 AGAGGATCTGGAAGGTGCAAGGG - Intergenic
1146003765 17:29148201-29148223 AGGGGAACTAGAGGGACAAATGG - Intronic
1151412513 17:73940786-73940808 TGTGGACCTGGAGTGACAAATGG - Intergenic
1151534270 17:74729859-74729881 AGAAGATCTGGAGGGACAAAGGG + Intronic
1151635722 17:75346536-75346558 ACTGGATCTGGAGAGACAGATGG - Intronic
1152048006 17:77951238-77951260 AGTGGCTCTGGAGGGAGGACAGG + Intergenic
1152491159 17:80635574-80635596 AGTGGATCTGGTGGGAGAAGAGG + Intronic
1152541393 17:80978453-80978475 CTTGAACCTGGAGGGACCAAAGG - Intergenic
1154201679 18:12304909-12304931 AGGGGACCCGGAGGGGCCAATGG - Intergenic
1154389317 18:13922942-13922964 AGGGGATCTGGAGAGGCAAATGG + Intergenic
1155797215 18:30054938-30054960 ATCCGATCTGAAGGGACCAAAGG - Intergenic
1156245493 18:35293833-35293855 AGTAGATCTGGAGGGGTAAAAGG + Intergenic
1157339833 18:46769155-46769177 AGTGGACCAGGAGAGACCACAGG - Intergenic
1158191533 18:54833884-54833906 AGTGAGTCTGGAGGCACCAATGG + Intronic
1158391541 18:57049123-57049145 AGTGGCCCTGGAGGTCCCAAAGG - Intergenic
1160572821 18:79830566-79830588 GGCGGTTCTGGAGGGACCCATGG - Intergenic
1161186918 19:2927206-2927228 AGAGATTCTGGAGGGACCAGGGG + Intergenic
1161424992 19:4198414-4198436 AGAGGGTCTGGAGGGACCGCGGG - Intronic
1163775278 19:19213674-19213696 TGTGTATCTGGAGGGGCCAAGGG + Intronic
1163827395 19:19531273-19531295 TGTGGCTCTGGAGACACCAAGGG + Intronic
1164462097 19:28457615-28457637 AGTGGATCAGGAGGGCTGAATGG + Intergenic
1166873366 19:45883792-45883814 AGGGAAACTGGAGGGGCCAAGGG + Exonic
1166918560 19:46212914-46212936 AGTGGAGCTGGCGGGACCCCTGG - Intergenic
1166921003 19:46229196-46229218 AGTGGAGCTGGCGGGACCCCTGG - Intergenic
1167224751 19:48230359-48230381 CGAGGAACTGGAGGGGCCAAGGG + Intronic
925082561 2:1081627-1081649 AGTGCCTGTGGAGGCACCAAGGG - Intronic
925280591 2:2681977-2681999 ACTGGTTCTGGATGGACCCACGG + Intergenic
926591120 2:14741325-14741347 AGGGGATCTAGAGAGTCCAAGGG - Intergenic
926853021 2:17221810-17221832 ACTGGCTCTGCAGGGACTAAGGG - Intergenic
927452875 2:23223952-23223974 AGTGGATCTGGAGGTGCAAATGG - Intergenic
929054737 2:37866246-37866268 AGTGGTTCTGCAGGGACCACAGG - Intergenic
929154228 2:38774979-38775001 AGAGGCTCTAGGGGGACCAAGGG + Intronic
930383257 2:50658781-50658803 TATGGATCTGGAGGGATAAAAGG - Intronic
930974984 2:57446677-57446699 TGTGGATTTGTAGGGACAAATGG - Intergenic
931928360 2:67099873-67099895 AGTAGATCAGGAGTGACCCATGG + Intergenic
933778359 2:85785431-85785453 AGTGGCTCAGGAGGGAGAAAAGG - Intronic
934625575 2:95847576-95847598 AATGGATTTGATGGGACCAATGG + Intronic
934807997 2:97253742-97253764 AATGGATTTGATGGGACCAATGG - Intronic
934829513 2:97503445-97503467 AATGGATTTGATGGGACCAATGG + Intronic
936810062 2:116387875-116387897 ACTGGATCTGGAGAGACAAATGG - Intergenic
937975609 2:127580649-127580671 AGTGGATCTGGGGCTGCCAAGGG + Intronic
938009922 2:127820759-127820781 AGTGGAGCTGGAGGGGCTGATGG - Intergenic
938954121 2:136282788-136282810 TGTGGGTCTGGAGGGACCTGTGG + Intergenic
939706429 2:145458921-145458943 AGTGGAGCTGGTGAGAACAAGGG + Intergenic
941548915 2:166889680-166889702 AGTGGATCTGGACAGGCTAAAGG - Intronic
941653996 2:168123982-168124004 AGTGGATCCAGTGGGGCCAAGGG + Intronic
941880611 2:170476704-170476726 AGGGGATGTGGTGGGCCCAAAGG + Intronic
942004013 2:171679691-171679713 AGTGCATCTGGAGGGGCAAAGGG - Intergenic
942068143 2:172291279-172291301 AGTGGAGCTGGAGGGACAAATGG - Intergenic
943685449 2:190813098-190813120 AGTGAATCTGGAGGGGTTAATGG - Intergenic
943860934 2:192861853-192861875 AGTAGGACTGGAGGGACCAATGG - Intergenic
944932340 2:204532621-204532643 GGTGGATCTGAAGGGACGTAGGG - Intergenic
945507188 2:210656424-210656446 AGTGCATCTGTTAGGACCAAAGG + Intronic
945988432 2:216372492-216372514 AGGGGATGGGGAGGGACCAAGGG + Intergenic
946453029 2:219797555-219797577 ACTGGATCTGCAGTGACCAGTGG - Intergenic
946475798 2:220005397-220005419 AGTGGATCTGCAGGGGCAAATGG - Intergenic
946954037 2:224909017-224909039 AGTGGCTCAAGAGGGAACAAAGG - Intronic
948163570 2:235844285-235844307 AGTGGGTTTGGAGGGGGCAAGGG + Intronic
1169227713 20:3866481-3866503 GGTGGAGCAGGAGGGACCACTGG + Exonic
1170117277 20:12873681-12873703 AATGGATCTGAAGGGACAAAGGG + Intergenic
1170827863 20:19811522-19811544 AGTGGGTGTGGAGGGGACAAGGG + Intergenic
1172997739 20:39083501-39083523 AGTGGACCTGGAGGGGCCAGGGG + Intergenic
1173337512 20:42124843-42124865 AGGGGAAATGGAGGGACAAAGGG - Intronic
1173366085 20:42386495-42386517 AGTGGAACTGGACAAACCAAAGG + Intronic
1173902601 20:46601830-46601852 AGTGGAGCTGCAGGGGCCAGAGG + Intronic
1174601434 20:51728138-51728160 AGTGGCTCAAGAGGCACCAATGG - Intronic
1175047608 20:56122132-56122154 ATTGAATCTGGAGGGCTCAAGGG - Intergenic
1175056552 20:56204230-56204252 AGTGGATCTGACAGGACCACAGG - Intergenic
1176002723 20:62840226-62840248 AGTGGATTTGGAGTGAGCAGGGG - Intronic
1176052420 20:63127054-63127076 AATGGAGCTGGAGGGTCCACGGG + Intergenic
1177931242 21:27286612-27286634 AGATGATCTGTAGGGACTAATGG + Intergenic
1181695436 22:24590632-24590654 AGAGGATCTGAAGGGAACACTGG - Intronic
949562294 3:5213962-5213984 AGTGGACCTGGAGGGGCAAATGG + Intronic
949805601 3:7952481-7952503 GGTGGGTCTGGAGAGACCAGGGG - Intergenic
950483858 3:13261285-13261307 GGTCGATGTGGAGGGACAAAGGG + Intergenic
952430975 3:33222407-33222429 AGTGGATCTGGAATGGCAAATGG + Intergenic
953250438 3:41241575-41241597 GGTGGCTCTGGAAGTACCAAGGG + Intronic
953731957 3:45457325-45457347 AGAGGGTCTGGAGGGGCAAATGG + Intronic
953860469 3:46540070-46540092 AGGGGAGGTGGAGGGAGCAATGG + Intronic
956199240 3:66689413-66689435 AGTGGATCTGGAGGGGCAAAAGG - Intergenic
956591355 3:70918473-70918495 AGTGAATCTGAATGGATCAAGGG + Intergenic
958095111 3:88934457-88934479 AGTCGCTCTGGAGGCTCCAAGGG + Intergenic
959428700 3:106224627-106224649 AGAAGATATGAAGGGACCAAGGG + Intergenic
960036312 3:113105996-113106018 AGTGTATCTGGAGGGGGCCAGGG - Intergenic
961077906 3:123998728-123998750 AGTGGACCTAGCGGGACAAATGG - Intergenic
962369369 3:134808087-134808109 AATGGATCTGCAGGGATGAATGG + Intronic
962941524 3:140128833-140128855 GGTGGATCTGGAGAGGCCAGTGG + Intronic
963226916 3:142871950-142871972 AGTGGATCTGGAGGGGCAAATGG - Intronic
963969542 3:151414375-151414397 AGTAGAGCTGGAGTGCCCAAGGG + Intronic
964090161 3:152866524-152866546 AATGGATCTGGAGGAGCAAATGG - Intergenic
965053933 3:163689664-163689686 AGTGCATAAGGTGGGACCAAGGG - Intergenic
966486669 3:180478913-180478935 AGTGGATTTGGAGGGGCAAAGGG - Intergenic
967872976 3:194247737-194247759 AGAGAGTCTGGAGGGACAAAGGG - Intergenic
968003197 3:195221709-195221731 ACTGGAGCTGGAGGGAGCCAAGG - Intronic
968038979 3:195572572-195572594 TGTGGAGATGGAGGCACCAAAGG + Intronic
968190817 3:196665900-196665922 AGTAGATCTGGAGGGGCAAATGG - Intronic
968447643 4:660383-660405 AGGGGATCTGGAGAGAAGAAAGG + Intronic
969357145 4:6635386-6635408 AGTGGATTGGGAGGGATGAATGG - Intergenic
970340441 4:15100730-15100752 AGTGAATCTTGAAGGACAAATGG + Intergenic
972249166 4:37281041-37281063 AGTGGGTCTGGAGGGGCAAAGGG + Intronic
972577401 4:40364462-40364484 TGTGAATCTGGAAGGACAAAGGG + Intergenic
972931190 4:44072730-44072752 TGTGGAGCTGGAGGGAGCCAGGG - Intergenic
972938919 4:44172908-44172930 ACTGGAGCTGGAGGGAAAAAAGG - Intergenic
973247214 4:48022229-48022251 AGTGGATGTGGAGTGGCCTACGG - Intronic
973310879 4:48708495-48708517 AGTGGAATTGCAGGGCCCAAGGG - Intronic
976712167 4:88084340-88084362 AGTGGATCTGAATGGTGCAAGGG - Intergenic
980795695 4:137679862-137679884 AGTGGGTCTGGAGGAACAAATGG - Intergenic
980870675 4:138607935-138607957 AGTGGTTCTGGAGGGGCAAATGG - Intergenic
981735212 4:147942600-147942622 AGAGGATAAGGAGGGAACAAAGG - Intronic
982182016 4:152757343-152757365 AGTGGGTTTTGTGGGACCAAAGG - Intronic
982549684 4:156782145-156782167 AGTTGTTCTGGAGGGAGAAATGG + Intronic
982749736 4:159145767-159145789 GGAGGAGCTGGAGGTACCAAGGG + Intronic
983461188 4:168027549-168027571 GGTGGAACTGGAGGAGCCAATGG + Intergenic
983914923 4:173281758-173281780 AGGAAATCTGGAGGGAACAAGGG - Intronic
984346868 4:178539549-178539571 AGTGCATAGGGAGGGAGCAAAGG - Intergenic
985712116 5:1435459-1435481 AGTGGCTCTGGAAGGACCCAGGG - Intronic
987794702 5:22611844-22611866 AGTGGATCTGGAGGGGCAAATGG + Intronic
988010002 5:25469739-25469761 AATGGATCAGGAGGCACAAATGG - Intergenic
989465233 5:41747234-41747256 AGTGGAACTGGTTGGAGCAAGGG - Intronic
991648873 5:68830854-68830876 AGTGGATGTGGAGGAGCCACAGG - Intergenic
993604188 5:89967634-89967656 AGTGGATCTGGTAGAACTAAGGG - Intergenic
994186152 5:96817252-96817274 AGTGGACCTATAGGGGCCAATGG + Intronic
996620320 5:125493544-125493566 AGTAGATCTGCATGGCCCAAGGG - Intergenic
997531540 5:134584520-134584542 ATTGGATCTGGAGGCACCCTTGG - Intergenic
999111553 5:149125751-149125773 CATGGATCTGGAGGGACAAACGG + Intergenic
999256387 5:150212012-150212034 AGTGAAGCTGGTGGGACCCATGG - Intronic
999419108 5:151425523-151425545 TGTGAATGTGGGGGGACCAATGG + Intergenic
1000748234 5:165062142-165062164 AGTGGATCTAGAGCGAACAGGGG - Intergenic
1001160110 5:169305342-169305364 AGTGGATCTGAAGAGTCCACTGG - Intergenic
1001181544 5:169525502-169525524 ATGAGATTTGGAGGGACCAAGGG - Intergenic
1001242392 5:170080515-170080537 AGTGAATCCTGAGGGCCCAAGGG - Intronic
1001317792 5:170656668-170656690 AGTGGACATGGAGGGGCAAATGG + Intronic
1001569309 5:172719693-172719715 AATGGTTCTGGAGGGGCCAGAGG + Intergenic
1001926339 5:175639924-175639946 AGAGGGTCTGGAGGGACAGATGG - Intergenic
1002056957 5:176603644-176603666 AGTGGAACTGGAGTGCCCATGGG + Intronic
1003509231 6:6765551-6765573 AGGAGATCTGGAGGGAACAAGGG + Intergenic
1003520898 6:6857393-6857415 AGTACTTCTGGATGGACCAAGGG - Intergenic
1005301808 6:24478500-24478522 AGTGGGTCTGGAAGGACAAATGG - Intronic
1006344267 6:33467160-33467182 ATGAGATTTGGAGGGACCAAGGG + Intergenic
1006941106 6:37753048-37753070 AGTGGGTCTGGAGGGGGCAAAGG - Intergenic
1007158190 6:39766674-39766696 AATGGATCTGGAGGGCCAAATGG - Intergenic
1007258780 6:40547525-40547547 TGTGGACCTGGAGGGTCAAATGG - Intronic
1007716677 6:43860165-43860187 AGTGGATTAGGAGGGACAAGAGG + Intergenic
1008426601 6:51365230-51365252 AGTGGATCTGGACAGGCAAATGG + Intergenic
1008633001 6:53381798-53381820 AGTCTATGTGGAGGCACCAAAGG - Intergenic
1008838393 6:55867037-55867059 AGTGGATCTTGAGGTACAAATGG - Intronic
1008850747 6:56018062-56018084 ACTGGATTTGGAAGGACAAATGG + Intergenic
1008880356 6:56375259-56375281 GGTGGATCTGGAGGGCCAAGTGG - Intronic
1009913540 6:69963685-69963707 AGTGGATCATGAGAGACCAATGG + Intronic
1013519946 6:110923859-110923881 ACTGGATCTGGATGGGCCAAAGG + Intergenic
1014456841 6:121645235-121645257 AGGAGATCTGGAGGGTCCCAGGG + Intergenic
1016107475 6:140180272-140180294 AGTGAATCTGGAGGAACAAATGG + Intergenic
1017068123 6:150548959-150548981 TCTGGATCTGGAGGGATAAATGG + Intergenic
1017076132 6:150620519-150620541 AGTGGGTGTGGAGGGCCCGATGG - Intronic
1017229467 6:152056990-152057012 AGTGGGTATGGATGGATCAACGG - Intronic
1019834709 7:3371242-3371264 AGTGGATCTTGAGGAAACTAGGG + Intronic
1022032306 7:26503665-26503687 AGGGCAGCAGGAGGGACCAAGGG - Intergenic
1022850724 7:34258987-34259009 AGTGGAGCTGGAGGGAGGACTGG + Intergenic
1023278574 7:38546857-38546879 AATGGATCTGGAGGGGCAACTGG - Intronic
1024585193 7:50836004-50836026 AGTGTATGTGGAGGGAGAAAGGG - Intergenic
1026345798 7:69473197-69473219 AGTGAATCAGAAAGGACCAAAGG + Intergenic
1027172650 7:75883658-75883680 AGTGAAACTGGAGGCAGCAAAGG - Intronic
1029192812 7:98783762-98783784 TGTGGATTTGGAGAGACCAAGGG - Intergenic
1029275284 7:99400322-99400344 ACTGGATCTGGACGGGCCAAAGG - Exonic
1030045451 7:105491058-105491080 AGTTGATGTGGAGGGAACACAGG - Intronic
1030884819 7:114923330-114923352 AGGGGGAGTGGAGGGACCAACGG - Intronic
1031054583 7:116979233-116979255 AGTGGAAGGGGAGGGACAAATGG + Intronic
1033128018 7:138721798-138721820 GGTGGGTCTGGAGGGCCCCACGG - Intronic
1033189663 7:139265824-139265846 AGAGCCTCTGGAGGGACCATGGG + Intronic
1034876652 7:154730299-154730321 TGTGGAGCTGCAGGGACCCAGGG + Intronic
1034926927 7:155130014-155130036 CGTGGATGTGAAGGCACCAAGGG + Intergenic
1034939272 7:155220040-155220062 GGTGGATCTGGATTGCCCAAGGG - Intergenic
1035956777 8:4088983-4089005 AGGGGATCTGTATGCACCAAGGG - Intronic
1036778155 8:11627935-11627957 AGAGAATCTGGAGGGCCCTACGG + Intergenic
1039762151 8:40589577-40589599 ATGGAGTCTGGAGGGACCAATGG - Intronic
1039846558 8:41329811-41329833 AGGGAAGCTGGAGGGACCATTGG - Intergenic
1040943240 8:52853847-52853869 ATTAGATCTGGAGTGACCTAAGG + Intergenic
1040963801 8:53064145-53064167 AAAGGATCTGCAGGGACCAGAGG - Intergenic
1042574909 8:70206977-70206999 TGTGGAACTGTAGGGAACAATGG - Intronic
1042746723 8:72116207-72116229 AGTTTATATGGAGAGACCAAAGG - Intronic
1042934594 8:74045958-74045980 AGAGCATCTGGAGGGATGAATGG + Intergenic
1044454211 8:92373566-92373588 AATTGATCTGGAAAGACCAAAGG - Intergenic
1045291981 8:100841702-100841724 AGTGGAGCTAGAGGGGCAAATGG - Intergenic
1047006893 8:120630128-120630150 ACTGGATCTGAAGGGGCAAAGGG - Intronic
1047141163 8:122141337-122141359 AGTCGATCTGGATGGTGCAAGGG - Intergenic
1047170037 8:122483867-122483889 AGTGGATCTTGAGGTGCAAATGG - Intergenic
1047773484 8:128049530-128049552 AGTGGACCTGGAGGGGCCCACGG - Intergenic
1048879971 8:138864086-138864108 AGAGGAAGAGGAGGGACCAAGGG + Intronic
1049365531 8:142235103-142235125 CTTGGGGCTGGAGGGACCAAGGG + Intronic
1049439529 8:142602815-142602837 AGGGATTCTGGAGGGACCAGAGG + Intergenic
1050432383 9:5574929-5574951 AGTGGATCTGGAGGGTCAAATGG - Intergenic
1051744398 9:20280934-20280956 AGAGCATCTGGAGGAACAAATGG + Intergenic
1052472823 9:28921706-28921728 AGTGGATGTGGAAGGATGAATGG - Intergenic
1052665745 9:31493212-31493234 AGTTGATATGGAGGGAACATTGG - Intergenic
1053053664 9:34980944-34980966 GGTGGAGCTGCAGGGACCGAGGG + Exonic
1055955897 9:81773235-81773257 AGTGGATCTGGAGGGGCAAAAGG + Intergenic
1056113074 9:83415299-83415321 AGTGGCTCTGGAGGAGCAAATGG + Intronic
1056320356 9:85429629-85429651 AGTGGACCTGGAGGAGCCAAAGG + Intergenic
1056334215 9:85550227-85550249 AGGGGATCTGGAAGGAGCTAGGG + Intronic
1057935269 9:99233167-99233189 AATGGCTCTGGAGCTACCAAGGG - Intergenic
1058154458 9:101499267-101499289 TGTGGAAGTGGAGGGATCAAAGG + Intronic
1059506407 9:114803540-114803562 AGAGGATCTGGAGGGACTGATGG - Intronic
1061159015 9:128882556-128882578 TGAGGATCTGGGGGGACCCAGGG - Exonic
1061222453 9:129260104-129260126 CATGGATCCGGAGGAACCAATGG - Intergenic
1062058552 9:134482208-134482230 AGTGGATCTGGGGGACCAAAAGG - Intergenic
1186117670 X:6321955-6321977 AGTGGTTCTGCTGTGACCAAAGG + Intergenic
1186941301 X:14510489-14510511 AGGGAATCTGGAGGGACAAAGGG + Intergenic
1187044849 X:15637136-15637158 AGAAGACCTGGAGGGACCATGGG - Intronic
1187696050 X:21922124-21922146 ATTGGAGCTGGAGGTACCATTGG - Intergenic
1187941641 X:24388331-24388353 ACTGGATCTGGAGGGACAAATGG - Intergenic
1188464725 X:30467059-30467081 AGTGGATCTGGTGGGGCAGATGG - Intergenic
1189425634 X:40897440-40897462 GGTGGGTCTGGAGGGGTCAAAGG - Intergenic
1189744622 X:44157381-44157403 AATGGATCTTGAGGGGCAAATGG - Intronic
1198068264 X:133121604-133121626 AGTCAGTCTGGAGGGACCAGGGG + Intergenic
1199094528 X:143724075-143724097 ACTGGATCTGAAGAGAGCAATGG + Intergenic
1199842473 X:151664216-151664238 AGTGGACCAGGAGGGCCCAATGG + Exonic