ID: 1065257391

View in Genome Browser
Species Human (GRCh38)
Location 10:23884805-23884827
Sequence GAAACTAGTAAGCAAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065257391_1065257397 5 Left 1065257391 10:23884805-23884827 CCAGCAACTTGCTTACTAGTTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1065257397 10:23884833-23884855 CTTGGGAACAGTAGAGGGTCTGG No data
1065257391_1065257398 12 Left 1065257391 10:23884805-23884827 CCAGCAACTTGCTTACTAGTTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1065257398 10:23884840-23884862 ACAGTAGAGGGTCTGGCACCTGG No data
1065257391_1065257396 0 Left 1065257391 10:23884805-23884827 CCAGCAACTTGCTTACTAGTTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1065257396 10:23884828-23884850 CTGTTCTTGGGAACAGTAGAGGG No data
1065257391_1065257395 -1 Left 1065257391 10:23884805-23884827 CCAGCAACTTGCTTACTAGTTTC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1065257395 10:23884827-23884849 CCTGTTCTTGGGAACAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065257391 Original CRISPR GAAACTAGTAAGCAAGTTGC TGG (reversed) Intronic
903212318 1:21825052-21825074 AATACTAGTAACAAAGTTGCAGG - Exonic
906458932 1:46022609-46022631 GGAACTAGTAACCCAGTTTCAGG + Intronic
907695525 1:56723678-56723700 GAAACTAGCAAGAAATGTGCAGG + Exonic
908789380 1:67766717-67766739 GAAACCACAAAGCAAGCTGCTGG + Intronic
911289739 1:96042835-96042857 GAAATTATTTAGCAAGCTGCAGG - Intergenic
911657921 1:100465668-100465690 TAAACTAGAAACCAATTTGCTGG + Intronic
917565579 1:176208728-176208750 GAAACTGGACAGGAAGTTGCTGG + Intergenic
921024731 1:211267524-211267546 GAAACTGGTATCCAAGTTGTGGG - Intronic
923311282 1:232737843-232737865 GGAACTAGTTAGGAAGGTGCTGG - Intergenic
923388296 1:233487833-233487855 GTAACTAGTAAGCATGTTCTGGG - Intergenic
1065257391 10:23884805-23884827 GAAACTAGTAAGCAAGTTGCTGG - Intronic
1067701611 10:48577300-48577322 GAAAACAAAAAGCAAGTTGCAGG - Intronic
1070346541 10:75548315-75548337 GAAACAAGCAAGCAAGGTACTGG + Intronic
1071263032 10:83938265-83938287 GAAATCATTAAGCAAGTTTCTGG - Intergenic
1072015145 10:91339407-91339429 AAAACCAGTAATCAAATTGCGGG - Intergenic
1073962386 10:108947429-108947451 GAATCTGGTAAGCAAGTTTATGG - Intergenic
1075532724 10:123243654-123243676 GAGACTAGAAAGCAGGATGCTGG + Intergenic
1078612451 11:12832775-12832797 GAAACTTGTTAGCAATTGGCAGG - Intronic
1079508803 11:21185778-21185800 GAACTTAGTAAGCAAGGTGCAGG - Intronic
1088434916 11:109801722-109801744 GGAACTAGTTAACAATTTGCTGG + Intergenic
1090945584 11:131426719-131426741 TAAATTAGTAGGCAAGTGGCAGG + Intronic
1094005708 12:25748310-25748332 GAAATTAGTAAGCATTTTGTGGG + Intergenic
1094747190 12:33358429-33358451 GAAAAGGGTAAGCTAGTTGCTGG - Intergenic
1096104055 12:48986504-48986526 GCACCTAGTTGGCAAGTTGCTGG - Intergenic
1096758165 12:53817273-53817295 GACACTCATTAGCAAGTTGCAGG - Intergenic
1102361055 12:112288026-112288048 TACATTAGAAAGCAAGTTGCTGG + Intronic
1105689398 13:22820951-22820973 GAAACTAGAAAGCAAGGAGGTGG - Intergenic
1106668316 13:31876971-31876993 GAAACTAGTAAGAGACATGCAGG - Intergenic
1108239409 13:48446446-48446468 GCTACTAGCAAGCAAGATGCAGG - Intronic
1108768998 13:53673935-53673957 GAAACTAGAAATCATATTGCAGG + Intergenic
1110579772 13:77108502-77108524 GCAACTAATAAGCAACTTGTGGG - Intronic
1111782595 13:92747491-92747513 GAAAATAATAAGCAAGTCACTGG + Intronic
1115546047 14:34465620-34465642 GAAAGGAGTAAGCAAGTTTATGG + Intergenic
1115807363 14:37066039-37066061 GAAACTAATAAGCAGCTTGTGGG - Intronic
1116630722 14:47327901-47327923 GAAGCTAGAATGCAAGTTACAGG + Intronic
1117653063 14:57926539-57926561 GATACTAGAAAGCAAGTTGGGGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120698342 14:87669639-87669661 AAAACTATTAAGTATGTTGCAGG - Intergenic
1126947495 15:53839181-53839203 AAAAATAGTAAACATGTTGCTGG - Intergenic
1127710045 15:61588231-61588253 GAACATAGTTAGAAAGTTGCTGG - Intergenic
1128899741 15:71409409-71409431 GAAATGAGAAAGCAAGTTGTAGG + Intronic
1130849834 15:87782093-87782115 GAAACTTGTGAGCAAGTCGTTGG + Intergenic
1131289775 15:91097585-91097607 GAAACTAGGAATAGAGTTGCTGG - Intergenic
1131806019 15:96123584-96123606 GAAAAGCTTAAGCAAGTTGCTGG + Intergenic
1133877287 16:9747215-9747237 GAAACTAATCAGCAATTTGTGGG - Intergenic
1136479747 16:30534103-30534125 GAAACTGCTAAGCAGGTAGCTGG + Intronic
1136483616 16:30557639-30557661 GAAACTGCTAAGCAGGTAGCTGG + Intronic
1138974878 16:62192649-62192671 GAAACTAGTATAAAAGTTGTAGG + Intergenic
1142990488 17:3727273-3727295 GAAGCTAGTAAGCAACTTATAGG + Intronic
1145188351 17:20815988-20816010 GAAAACATTAAGCAAGTTGAAGG - Intergenic
1148858288 17:50591020-50591042 GAAACCCTAAAGCAAGTTGCTGG - Intronic
1149169646 17:53793357-53793379 GACACTACTATACAAGTTGCAGG + Intergenic
1149195180 17:54110937-54110959 GAAAATAGAATGCAAGTTTCTGG - Intergenic
1150078552 17:62215674-62215696 GAAAACATTAAGCAAGTTGAAGG + Intergenic
1150186805 17:63190601-63190623 GAAGCGAGTAAGCAAGCAGCTGG + Intronic
1150489594 17:65565086-65565108 GAAACTGGAAAGCAAGGTGATGG + Intronic
1152215449 17:79029179-79029201 TAAACAAGTAAGCAAATTGGTGG + Intronic
1153676828 18:7463354-7463376 GAAACAAGTAATGAAGTTCCTGG - Intergenic
1159404377 18:67981172-67981194 GAAAATATTAATCAAGTTGAGGG - Intergenic
1165480418 19:36060250-36060272 TAAACTAGTCAGCAAATTACGGG + Intronic
1166618988 19:44278367-44278389 GAAATTAATAAGCAATTTGTGGG - Intronic
1168348448 19:55662059-55662081 GAAAGTAGAAAGGAAGTGGCAGG - Intronic
927195052 2:20541195-20541217 GAAACTAGTGATCACCTTGCGGG + Intergenic
927465614 2:23334259-23334281 GAAACTAGGAAGCAAGAACCAGG + Intergenic
933019361 2:77172068-77172090 GGAAATTGTAAGGAAGTTGCAGG - Intronic
936430518 2:112458551-112458573 TAAACTTGTCACCAAGTTGCTGG - Intergenic
937197892 2:120176282-120176304 AAAACTAGAAAGCAAATTCCAGG - Exonic
939431680 2:142117559-142117581 GAACCAATAAAGCAAGTTGCTGG - Intronic
941082197 2:161074600-161074622 AAAAGTAGAAAGCAAGCTGCTGG + Intergenic
944214092 2:197236556-197236578 GAAACTAGTAGGCAACTAGTAGG - Intronic
946024017 2:216661084-216661106 AAAAAGAGTAAGCAAGTTTCAGG - Intronic
1181641271 22:24200720-24200742 TAAAATATTAAGCAATTTGCCGG - Intergenic
1183176443 22:36227889-36227911 AGAACTAGTAAACAAATTGCGGG - Exonic
952169876 3:30795205-30795227 TAAACTCTGAAGCAAGTTGCTGG + Intronic
954462821 3:50637337-50637359 AAAACCAGTAAGAAAGGTGCTGG + Intronic
957889438 3:86336727-86336749 TAAACTAGTAATGATGTTGCTGG - Intergenic
960221069 3:115109168-115109190 GAAACTTTTAAGATAGTTGCTGG - Intronic
960603643 3:119482517-119482539 TAAACTAGTAAGCAATTTTTAGG + Intronic
965387542 3:168062999-168063021 TAATCTAAGAAGCAAGTTGCTGG + Intronic
966957705 3:184900597-184900619 AAAACTAGTAAGCAAGTGAAAGG - Intronic
967321883 3:188202553-188202575 GAACCTTGTCAGCAAATTGCTGG - Intronic
972173005 4:36369504-36369526 GAAAATAGTAAGCACCTTGAAGG + Intergenic
974646577 4:64702533-64702555 GAAACAAGTAAGCATGCTCCTGG + Intergenic
978458083 4:108917553-108917575 TCAACTAGTAAGTATGTTGCAGG + Intronic
978591798 4:110331578-110331600 GTAACTAGTAAGCATGTTCTGGG + Intergenic
980785440 4:137548065-137548087 GAAACAAGTAAACTAGTTTCTGG + Intergenic
983569287 4:169187122-169187144 GAAACTAGGAAAAGAGTTGCAGG - Intronic
984261801 4:177451757-177451779 GCACCTAATAAGAAAGTTGCTGG + Intergenic
984350133 4:178579418-178579440 GACACTAGTAAGAAAGGAGCCGG + Intergenic
989853162 5:46241723-46241745 AAAACTAGTAAGCAGCTTTCTGG - Intergenic
992260386 5:74964686-74964708 GCATATAGTAAGGAAGTTGCTGG + Intergenic
999142296 5:149370593-149370615 GAGACTAGTAACCATGATGCAGG + Intergenic
1000239892 5:159399593-159399615 AAAACCAGTAAGCAAGCTGTTGG + Intergenic
1003221311 6:4163375-4163397 GAAAATAGAGGGCAAGTTGCTGG - Intergenic
1005318459 6:24627736-24627758 GAAACCAGTAAGAAGATTGCTGG - Intronic
1005392343 6:25346248-25346270 GAAACAAGGAAGCAAGTGGGCGG - Intronic
1005588409 6:27299721-27299743 GCAACTAATAAGCAATCTGCGGG + Intronic
1007711445 6:43826690-43826712 GGACCTAGAAAGCAATTTGCTGG + Intergenic
1009960522 6:70515464-70515486 GAAACTTGAAAGCATATTGCAGG + Intronic
1010509224 6:76697406-76697428 GACACTAGTTGGCAAGGTGCGGG - Intergenic
1011795858 6:90950435-90950457 GAAACCACTAAGCATATTGCAGG + Intergenic
1014589198 6:123242505-123242527 GAAATTAGAAAGCAAGAGGCTGG + Intronic
1020809905 7:12838951-12838973 GAAAATAGTAGGGAAGTTACAGG + Intergenic
1021585875 7:22207625-22207647 TAAAGTAGCAAGCAACTTGCTGG - Intronic
1022158028 7:27679998-27680020 GAAAATACTAAGCATGTAGCAGG - Intergenic
1024973784 7:55094617-55094639 GAAGTTAGAAAGGAAGTTGCTGG - Intronic
1029230352 7:99062466-99062488 GAAAATAGTAAGCAAGGGGAAGG + Intronic
1031020727 7:116625013-116625035 GAGAGTAGTAAGCAAACTGCAGG - Intergenic
1031849351 7:126845234-126845256 GTCACTAGTAATAAAGTTGCAGG - Intronic
1034534568 7:151718956-151718978 GAAACTACTTGGCAAGATGCAGG - Intronic
1034787536 7:153938696-153938718 GAAACTAAAAATGAAGTTGCAGG - Intronic
1039495068 8:37974406-37974428 GAAAATAGTAAGCATGGTGGGGG - Intergenic
1039510017 8:38084206-38084228 GAAACTCGTAAGCAAAATGCAGG - Intergenic
1040539834 8:48342579-48342601 GAAACTCATAAGCTAGTTGGGGG - Intergenic
1041067589 8:54097133-54097155 GTAATTAAAAAGCAAGTTGCGGG - Intronic
1045194338 8:99914908-99914930 GAAAATACTAAGGAAGTTCCCGG - Intergenic
1045318267 8:101061872-101061894 GAAAGTAGCAAGCAACTGGCTGG - Intergenic
1045332833 8:101170412-101170434 GTAACTGGAAAGCAAATTGCAGG + Intergenic
1046551859 8:115728223-115728245 GAAACTAGAAATAAAGTTGAAGG + Intronic
1047053887 8:121143187-121143209 GAGATTGGTAACCAAGTTGCAGG + Intergenic
1052829648 9:33204455-33204477 GTAAGTAGTATGCAATTTGCTGG - Intergenic
1193675396 X:84446615-84446637 GAAAGAAGTAAGCAAGATGAAGG + Intronic
1193930813 X:87548883-87548905 GAAACTAATAAGAAAATGGCAGG + Intronic
1196805917 X:119585770-119585792 GAAACTATTAAGCAAATTGAAGG - Intergenic
1197109007 X:122750007-122750029 GAAACTAGAAAGAAAGTGGGAGG + Intergenic