ID: 1065260707

View in Genome Browser
Species Human (GRCh38)
Location 10:23920656-23920678
Sequence CCTTTTGAACAGTCAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065260703_1065260707 12 Left 1065260703 10:23920621-23920643 CCTCTGCCACACTCTGAGATATA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG No data
1065260701_1065260707 14 Left 1065260701 10:23920619-23920641 CCCCTCTGCCACACTCTGAGATA 0: 1
1: 0
2: 0
3: 16
4: 272
Right 1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG No data
1065260702_1065260707 13 Left 1065260702 10:23920620-23920642 CCCTCTGCCACACTCTGAGATAT 0: 1
1: 0
2: 4
3: 15
4: 227
Right 1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG No data
1065260704_1065260707 6 Left 1065260704 10:23920627-23920649 CCACACTCTGAGATATAGTTGTC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065260707 Original CRISPR CCTTTTGAACAGTCAGTGAC AGG Intronic
No off target data available for this crispr