ID: 1065261717

View in Genome Browser
Species Human (GRCh38)
Location 10:23930769-23930791
Sequence AAGTTAACTCAGTGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065261714_1065261717 7 Left 1065261714 10:23930739-23930761 CCTTCATTGCACTCGAGCTCTGA 0: 1
1: 0
2: 0
3: 24
4: 280
Right 1065261717 10:23930769-23930791 AAGTTAACTCAGTGGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065261717 Original CRISPR AAGTTAACTCAGTGGGAACA TGG Intronic
No off target data available for this crispr