ID: 1065263762

View in Genome Browser
Species Human (GRCh38)
Location 10:23954176-23954198
Sequence TCTTCTAGTAAGTCAATAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065263761_1065263762 -8 Left 1065263761 10:23954161-23954183 CCATCTGAGCTTTCTTCTTCTAG 0: 1
1: 0
2: 1
3: 19
4: 339
Right 1065263762 10:23954176-23954198 TCTTCTAGTAAGTCAATAGACGG No data
1065263760_1065263762 21 Left 1065263760 10:23954132-23954154 CCAGGGGGCTGCTTTGTTTGTAT 0: 1
1: 0
2: 1
3: 14
4: 183
Right 1065263762 10:23954176-23954198 TCTTCTAGTAAGTCAATAGACGG No data
1065263759_1065263762 27 Left 1065263759 10:23954126-23954148 CCATTTCCAGGGGGCTGCTTTGT 0: 1
1: 0
2: 2
3: 22
4: 222
Right 1065263762 10:23954176-23954198 TCTTCTAGTAAGTCAATAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065263762 Original CRISPR TCTTCTAGTAAGTCAATAGA CGG Intronic
No off target data available for this crispr