ID: 1065266497

View in Genome Browser
Species Human (GRCh38)
Location 10:23982047-23982069
Sequence GTAGTGGTGAGCCATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065266494_1065266497 8 Left 1065266494 10:23982016-23982038 CCAAAAGCTGAGAATGGAACTGG 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1065266497 10:23982047-23982069 GTAGTGGTGAGCCATGTGCCTGG No data
1065266492_1065266497 12 Left 1065266492 10:23982012-23982034 CCTCCCAAAAGCTGAGAATGGAA 0: 1
1: 0
2: 2
3: 18
4: 262
Right 1065266497 10:23982047-23982069 GTAGTGGTGAGCCATGTGCCTGG No data
1065266493_1065266497 9 Left 1065266493 10:23982015-23982037 CCCAAAAGCTGAGAATGGAACTG 0: 1
1: 0
2: 1
3: 37
4: 330
Right 1065266497 10:23982047-23982069 GTAGTGGTGAGCCATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065266497 Original CRISPR GTAGTGGTGAGCCATGTGCC TGG Intronic
No off target data available for this crispr