ID: 1065270055

View in Genome Browser
Species Human (GRCh38)
Location 10:24020257-24020279
Sequence TAGTTTTACAAGAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065270049_1065270055 15 Left 1065270049 10:24020219-24020241 CCATCACCTAGCCATCAGCAGAT 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270046_1065270055 18 Left 1065270046 10:24020216-24020238 CCCCCATCACCTAGCCATCAGCA 0: 1
1: 0
2: 0
3: 22
4: 280
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270047_1065270055 17 Left 1065270047 10:24020217-24020239 CCCCATCACCTAGCCATCAGCAG 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270045_1065270055 28 Left 1065270045 10:24020206-24020228 CCTGGGGCTACCCCCATCACCTA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270050_1065270055 9 Left 1065270050 10:24020225-24020247 CCTAGCCATCAGCAGATGCATGG 0: 1
1: 0
2: 3
3: 24
4: 246
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270048_1065270055 16 Left 1065270048 10:24020218-24020240 CCCATCACCTAGCCATCAGCAGA 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data
1065270052_1065270055 4 Left 1065270052 10:24020230-24020252 CCATCAGCAGATGCATGGTTGAT 0: 1
1: 0
2: 0
3: 44
4: 563
Right 1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065270055 Original CRISPR TAGTTTTACAAGAGGGAAGT TGG Intronic
No off target data available for this crispr