ID: 1065271843

View in Genome Browser
Species Human (GRCh38)
Location 10:24041080-24041102
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065271841_1065271843 16 Left 1065271841 10:24041041-24041063 CCAGCACATAACTGTGTCTGATA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1065271843 10:24041080-24041102 CACATTTATCAACTGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr