ID: 1065272371

View in Genome Browser
Species Human (GRCh38)
Location 10:24048204-24048226
Sequence CATGTATTACATATCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065272367_1065272371 -7 Left 1065272367 10:24048188-24048210 CCAGTTCGTCCAGATCCATGTAT 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1065272371 10:24048204-24048226 CATGTATTACATATCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065272371 Original CRISPR CATGTATTACATATCTATAT GGG Intronic
No off target data available for this crispr