ID: 1065274154

View in Genome Browser
Species Human (GRCh38)
Location 10:24068273-24068295
Sequence CTGAGGGTGTGGAGCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065274154_1065274158 12 Left 1065274154 10:24068273-24068295 CCATCTTAGCTCCACACCCTCAG No data
Right 1065274158 10:24068308-24068330 TCAGCTCCAAGATTTCTGTTTGG 0: 11
1: 60
2: 139
3: 317
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065274154 Original CRISPR CTGAGGGTGTGGAGCTAAGA TGG (reversed) Intronic
No off target data available for this crispr