ID: 1065278347

View in Genome Browser
Species Human (GRCh38)
Location 10:24109073-24109095
Sequence ACTTTGGGAGCCTGAGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065278347_1065278355 21 Left 1065278347 10:24109073-24109095 CCAACGCCTCAGGCTCCCAAAGT No data
Right 1065278355 10:24109117-24109139 TACCGTGCCTGGCCAAGACTGGG No data
1065278347_1065278350 -9 Left 1065278347 10:24109073-24109095 CCAACGCCTCAGGCTCCCAAAGT No data
Right 1065278350 10:24109087-24109109 TCCCAAAGTGTTGGTATTACAGG 0: 258
1: 25610
2: 328167
3: 254379
4: 131336
1065278347_1065278354 20 Left 1065278347 10:24109073-24109095 CCAACGCCTCAGGCTCCCAAAGT No data
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278347_1065278353 10 Left 1065278347 10:24109073-24109095 CCAACGCCTCAGGCTCCCAAAGT No data
Right 1065278353 10:24109106-24109128 CAGGCATGAGCTACCGTGCCTGG 0: 191
1: 8282
2: 45239
3: 117251
4: 161526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065278347 Original CRISPR ACTTTGGGAGCCTGAGGCGT TGG (reversed) Intronic
No off target data available for this crispr