ID: 1065278349

View in Genome Browser
Species Human (GRCh38)
Location 10:24109079-24109101
Sequence ACCAACACTTTGGGAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359508
Summary {0: 3, 1: 189, 2: 9868, 3: 114757, 4: 234691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065278349_1065278355 15 Left 1065278349 10:24109079-24109101 CCTCAGGCTCCCAAAGTGTTGGT 0: 3
1: 189
2: 9868
3: 114757
4: 234691
Right 1065278355 10:24109117-24109139 TACCGTGCCTGGCCAAGACTGGG No data
1065278349_1065278353 4 Left 1065278349 10:24109079-24109101 CCTCAGGCTCCCAAAGTGTTGGT 0: 3
1: 189
2: 9868
3: 114757
4: 234691
Right 1065278353 10:24109106-24109128 CAGGCATGAGCTACCGTGCCTGG 0: 191
1: 8282
2: 45239
3: 117251
4: 161526
1065278349_1065278354 14 Left 1065278349 10:24109079-24109101 CCTCAGGCTCCCAAAGTGTTGGT 0: 3
1: 189
2: 9868
3: 114757
4: 234691
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065278349 Original CRISPR ACCAACACTTTGGGAGCCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr