ID: 1065278351

View in Genome Browser
Species Human (GRCh38)
Location 10:24109088-24109110
Sequence GCCTGTAATACCAACACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718692
Summary {0: 178, 1: 19668, 2: 254248, 3: 275462, 4: 169136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065278351_1065278355 6 Left 1065278351 10:24109088-24109110 CCCAAAGTGTTGGTATTACAGGC 0: 178
1: 19668
2: 254248
3: 275462
4: 169136
Right 1065278355 10:24109117-24109139 TACCGTGCCTGGCCAAGACTGGG No data
1065278351_1065278354 5 Left 1065278351 10:24109088-24109110 CCCAAAGTGTTGGTATTACAGGC 0: 178
1: 19668
2: 254248
3: 275462
4: 169136
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278351_1065278353 -5 Left 1065278351 10:24109088-24109110 CCCAAAGTGTTGGTATTACAGGC 0: 178
1: 19668
2: 254248
3: 275462
4: 169136
Right 1065278353 10:24109106-24109128 CAGGCATGAGCTACCGTGCCTGG 0: 191
1: 8282
2: 45239
3: 117251
4: 161526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065278351 Original CRISPR GCCTGTAATACCAACACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr