ID: 1065278352

View in Genome Browser
Species Human (GRCh38)
Location 10:24109089-24109111
Sequence TGCCTGTAATACCAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615637
Summary {0: 96, 1: 8829, 2: 117498, 3: 250279, 4: 238935}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065278352_1065278355 5 Left 1065278352 10:24109089-24109111 CCAAAGTGTTGGTATTACAGGCA 0: 96
1: 8829
2: 117498
3: 250279
4: 238935
Right 1065278355 10:24109117-24109139 TACCGTGCCTGGCCAAGACTGGG No data
1065278352_1065278354 4 Left 1065278352 10:24109089-24109111 CCAAAGTGTTGGTATTACAGGCA 0: 96
1: 8829
2: 117498
3: 250279
4: 238935
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278352_1065278353 -6 Left 1065278352 10:24109089-24109111 CCAAAGTGTTGGTATTACAGGCA 0: 96
1: 8829
2: 117498
3: 250279
4: 238935
Right 1065278353 10:24109106-24109128 CAGGCATGAGCTACCGTGCCTGG 0: 191
1: 8282
2: 45239
3: 117251
4: 161526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065278352 Original CRISPR TGCCTGTAATACCAACACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr