ID: 1065278354

View in Genome Browser
Species Human (GRCh38)
Location 10:24109116-24109138
Sequence CTACCGTGCCTGGCCAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065278347_1065278354 20 Left 1065278347 10:24109073-24109095 CCAACGCCTCAGGCTCCCAAAGT No data
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278351_1065278354 5 Left 1065278351 10:24109088-24109110 CCCAAAGTGTTGGTATTACAGGC 0: 178
1: 19668
2: 254248
3: 275462
4: 169136
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278349_1065278354 14 Left 1065278349 10:24109079-24109101 CCTCAGGCTCCCAAAGTGTTGGT 0: 3
1: 189
2: 9868
3: 114757
4: 234691
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data
1065278352_1065278354 4 Left 1065278352 10:24109089-24109111 CCAAAGTGTTGGTATTACAGGCA 0: 96
1: 8829
2: 117498
3: 250279
4: 238935
Right 1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065278354 Original CRISPR CTACCGTGCCTGGCCAAGAC TGG Intronic
No off target data available for this crispr