ID: 1065280040

View in Genome Browser
Species Human (GRCh38)
Location 10:24127336-24127358
Sequence CCTACCTTGAAAAAATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065280027_1065280040 30 Left 1065280027 10:24127283-24127305 CCACAGCCTGGTGTGTTGAGAAA 0: 1
1: 0
2: 1
3: 21
4: 237
Right 1065280040 10:24127336-24127358 CCTACCTTGAAAAAATTTTCAGG No data
1065280028_1065280040 24 Left 1065280028 10:24127289-24127311 CCTGGTGTGTTGAGAAAAGATAG No data
Right 1065280040 10:24127336-24127358 CCTACCTTGAAAAAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065280040 Original CRISPR CCTACCTTGAAAAAATTTTC AGG Intronic
No off target data available for this crispr