ID: 1065283454

View in Genome Browser
Species Human (GRCh38)
Location 10:24164441-24164463
Sequence GACAGCTTACACTCTATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065283454_1065283462 27 Left 1065283454 10:24164441-24164463 CCTCCAATAGAGTGTAAGCTGTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1065283462 10:24164491-24164513 TTACTGCCACATCTCCAGTCTGG No data
1065283454_1065283457 4 Left 1065283454 10:24164441-24164463 CCTCCAATAGAGTGTAAGCTGTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1065283457 10:24164468-24164490 AGAGGTAACCCCATCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065283454 Original CRISPR GACAGCTTACACTCTATTGG AGG (reversed) Intronic
901358139 1:8670436-8670458 GAGAGATTACAATCTAGTGGGGG + Intronic
903040909 1:20529591-20529613 GTGAGCTTACATTCTATTGGAGG - Intergenic
903252504 1:22066200-22066222 GAGAGCTTAAAATCTATTAGAGG + Intronic
904233048 1:29093163-29093185 GAATGCTTACACACTGTTGGTGG - Intronic
905243449 1:36596234-36596256 GACAGAATACACTCTCGTGGAGG - Intergenic
905518975 1:38583184-38583206 GAATGCTTACACACTGTTGGTGG + Intergenic
907561893 1:55398755-55398777 AACAGCTTACAGTGTATTTGTGG + Intergenic
908663451 1:66463033-66463055 GAATGCTTATACACTATTGGTGG - Intergenic
908811813 1:67989099-67989121 GAATGCTTATACACTATTGGTGG - Intergenic
909501795 1:76342688-76342710 GAAAGCTTATACACTGTTGGTGG - Intronic
909564797 1:77042371-77042393 GAAAGCTTACACTTTAGTGAGGG - Intronic
910234568 1:85022538-85022560 TAAAGCTTACATTCTAGTGGAGG + Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
912524941 1:110275389-110275411 GAATGCTTATACACTATTGGTGG + Intronic
912943403 1:114065204-114065226 CTCAGCTTACAGTCTATTGTGGG - Intergenic
913178211 1:116294627-116294649 GAATGCTTACACACTGTTGGTGG + Intergenic
913590366 1:120319046-120319068 GAATGCTTACACGCTGTTGGTGG + Intergenic
913596409 1:120382553-120382575 GAACGCTTATACACTATTGGTGG + Intergenic
913617820 1:120579317-120579339 GAATGCTTACACGCTGTTGGTGG - Intergenic
914090860 1:144496430-144496452 GAATGCTTATACACTATTGGTGG - Intergenic
914307743 1:146437786-146437808 GAACGCTTATACACTATTGGTGG + Intergenic
914572452 1:148931655-148931677 GAATGCTTACACGCTGTTGGTGG + Intronic
914576811 1:148979322-148979344 GAAAGCTTACTATCTAGTGGAGG - Intronic
914594368 1:149135347-149135369 GAACGCTTATACACTATTGGTGG - Intergenic
914600387 1:149198607-149198629 GAATGCTTACACGCTGTTGGTGG - Intergenic
915389560 1:155529302-155529324 GAGTGCTTATACACTATTGGTGG - Intronic
915599933 1:156915738-156915760 GGGAGCTTACAGTCTAGTGGGGG - Exonic
917820278 1:178755800-178755822 GAAGGCTTACACACTGTTGGTGG - Intronic
918137951 1:181693183-181693205 GAATGCTTATACTCTGTTGGTGG + Intronic
918479260 1:184960570-184960592 TACAGCTTACATTCTAGTGGTGG + Intronic
919041497 1:192394152-192394174 TGGAGCTTACATTCTATTGGAGG + Intergenic
919235193 1:194831895-194831917 GAAAGCTTATACACTGTTGGTGG + Intergenic
920042383 1:203110047-203110069 GAAAGCTTATACACTGTTGGTGG + Intronic
920951982 1:210580936-210580958 GAATGCTTTCACACTATTGGTGG - Intronic
921503873 1:215942306-215942328 GACAGGTTACAATCTTATGGAGG + Intronic
921739815 1:218670770-218670792 GAATGCTTACATACTATTGGCGG + Intergenic
921878917 1:220231458-220231480 GGGAGCTTACACTCTATGAGAGG - Intronic
921975546 1:221199075-221199097 GTCTGCTTATACACTATTGGTGG + Intergenic
921983225 1:221281078-221281100 GAAAGCTTATACACTGTTGGTGG - Intergenic
923321414 1:232837625-232837647 GACTGCTTATACACTGTTGGTGG + Intergenic
923575025 1:235150745-235150767 CACAGCTTACAGTCTGGTGGAGG + Intronic
923985151 1:239373496-239373518 GAAAGCTTATACACTGTTGGTGG - Intergenic
924255296 1:242176955-242176977 GAAAGCTTGCACACTGTTGGTGG + Intronic
1062853524 10:765367-765389 GAAATCTTACACACTGTTGGTGG + Intergenic
1064407467 10:15076965-15076987 GAATGCTTATACACTATTGGTGG + Intergenic
1064810995 10:19198011-19198033 GAAAGCTTAGACTCTAGTGTGGG - Intronic
1064921334 10:20522273-20522295 GAAGGCTTACACACTATGGGTGG - Intergenic
1065234406 10:23633992-23634014 GAACTCTTACACACTATTGGTGG - Intergenic
1065283454 10:24164441-24164463 GACAGCTTACACTCTATTGGAGG - Intronic
1065406200 10:25368613-25368635 GACTGCTTATACTCTGTTGGTGG + Intronic
1066016394 10:31248581-31248603 GAATGCTTACACACTGTTGGTGG - Intergenic
1067009781 10:42700255-42700277 GGGAGCTTACATTCTAGTGGGGG + Intergenic
1067345568 10:45435892-45435914 GAATGCTTACACACTGTTGGTGG - Intronic
1067672743 10:48339930-48339952 GAACGCTTACACGCTGTTGGTGG + Intronic
1068547217 10:58360975-58360997 AACAGGTTACAATCTATTGAGGG - Intronic
1068944473 10:62715653-62715675 GACCACTTACACAGTATTGGTGG + Intergenic
1069220924 10:65882273-65882295 GAAATCTTACACACTGTTGGTGG - Intergenic
1069240510 10:66132431-66132453 GAAAGCTTATACACTGTTGGTGG + Intronic
1069938660 10:71937943-71937965 GAGAGCTTACAGTCTAGTGGGGG - Intergenic
1070733848 10:78850206-78850228 TAGAGCTTACACTCCAGTGGAGG - Intergenic
1070894270 10:79968785-79968807 GAATGCTTACACACTGTTGGTGG - Intronic
1071581880 10:86779348-86779370 GAACACTTACACTTTATTGGTGG - Intronic
1071934720 10:90515776-90515798 GAACACTTACACTCTGTTGGTGG - Intergenic
1072483885 10:95835550-95835572 GAATGCTTACACACTGTTGGTGG - Intronic
1073780496 10:106833113-106833135 GAAAGCTTACACTATATTATTGG + Intronic
1073913139 10:108370498-108370520 GAATGCTTATACACTATTGGTGG + Intergenic
1074350919 10:112736317-112736339 CATAGCTTACAATCTAGTGGTGG - Intronic
1074663962 10:115696622-115696644 GAATGCTTACACACTGTTGGTGG - Intronic
1077812434 11:5651754-5651776 GAATGCTTACACACTACTGGTGG - Intergenic
1077839434 11:5959236-5959258 GAATGCTTACACACTGTTGGTGG - Intergenic
1078024084 11:7678317-7678339 GAACGCTTATACTCTGTTGGTGG + Intergenic
1078039161 11:7841877-7841899 GAATGCTTATACACTATTGGTGG - Intergenic
1078522141 11:12071938-12071960 GACTGCTTACACAGTATTGAAGG - Intergenic
1078628177 11:12977655-12977677 GTCAGCTCACACTCCATTTGTGG - Intergenic
1079001462 11:16760727-16760749 TAAAGCTTAGACTCTAGTGGAGG + Intergenic
1079709546 11:23664730-23664752 GAATGCTTACACACTGTTGGTGG - Intergenic
1079978307 11:27120923-27120945 TATAGCTTATACTCTAATGGGGG + Intronic
1080217073 11:29856312-29856334 GAAAGCTTACACACTGCTGGTGG + Intergenic
1082679980 11:56155327-56155349 GACAGTAGACACTCGATTGGTGG - Intergenic
1082868386 11:57920474-57920496 GACAGTGTGCAATCTATTGGGGG - Intergenic
1082901556 11:58258932-58258954 GAAAGCTTACACACTGCTGGTGG - Intergenic
1083441736 11:62680965-62680987 CACAGCTTACCCTCAAGTGGTGG - Intergenic
1085380140 11:76109014-76109036 GACTGCTTAGACTGTTTTGGTGG + Intronic
1086307033 11:85492396-85492418 GACAGCTTCCTCTATATTAGTGG - Intronic
1086308816 11:85512721-85512743 GAATGCTTATACACTATTGGTGG + Intronic
1087005866 11:93470659-93470681 GAACGCTTATACGCTATTGGTGG - Intergenic
1087488314 11:98787914-98787936 GAATGCTTATACTCTGTTGGTGG - Intergenic
1087595687 11:100252028-100252050 GAAGTCTTACACACTATTGGTGG - Intronic
1088099376 11:106138193-106138215 GAATGCTTATACTCTGTTGGTGG + Intergenic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1090597814 11:128338009-128338031 AGCAGCTTACACTCTAATAGGGG + Intergenic
1090722063 11:129484808-129484830 GAACGCTTACACACTGTTGGTGG - Intergenic
1091891392 12:4057483-4057505 GACAGCTTACAGTAGATTGGGGG - Intergenic
1092483703 12:8883225-8883247 GAGATCTTACACTCTGATGGGGG - Intronic
1092580775 12:9838517-9838539 GAAAGCTTTTACACTATTGGCGG + Intronic
1095697757 12:45159737-45159759 GAATGCTTACACACTTTTGGTGG - Intergenic
1095734545 12:45542147-45542169 GAATGCTTTCACACTATTGGTGG - Intergenic
1096185807 12:49579845-49579867 CAAAGCTTACATTCTATGGGGGG - Intronic
1096734921 12:53645432-53645454 GAATGCTTACATACTATTGGTGG + Intronic
1096963645 12:55606034-55606056 GACTGCTTATACTCTGTTGGCGG + Intergenic
1097360443 12:58653858-58653880 GACAGCTTGCACTGTGTTGCTGG - Intronic
1097370364 12:58771452-58771474 GAACGCTTACACACTGTTGGTGG + Intronic
1098823472 12:75263379-75263401 GAAAGCTTACACACTATTGGTGG - Intergenic
1100145096 12:91668106-91668128 GACAGGTTTCACTTTACTGGGGG - Intergenic
1100175400 12:92024433-92024455 GAATGCTTACATACTATTGGTGG + Intronic
1100374350 12:93999354-93999376 GAATGCTTACACACTGTTGGTGG + Intergenic
1100466654 12:94851900-94851922 GAACTCTTACACACTATTGGTGG + Intergenic
1100787493 12:98094380-98094402 GAATGCTTACACACTATTGGTGG - Intergenic
1101310089 12:103570256-103570278 GAATGCTTATACACTATTGGTGG + Intergenic
1101656744 12:106728508-106728530 TAGAGCTTACAATCTAGTGGAGG + Intronic
1101847918 12:108378136-108378158 GAATGCTTACACACTGTTGGTGG + Intergenic
1102508517 12:113398905-113398927 GACTGCGTACCCTCTACTGGGGG + Intronic
1103891761 12:124244370-124244392 GAGCACTTACACACTATTGGTGG - Intronic
1104517904 12:129444860-129444882 GAATGCTTACACACTGTTGGTGG + Intronic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1105698934 13:22920028-22920050 GAATTCTTACACACTATTGGTGG - Intergenic
1105776075 13:23661653-23661675 GAATGCTTACACACTGTTGGTGG - Intronic
1105850683 13:24332870-24332892 GAATTCTTACACACTATTGGTGG - Intergenic
1106372360 13:29148053-29148075 AACAGCTTATACACTGTTGGTGG - Intronic
1106652707 13:31708792-31708814 GAAAGCTTGCACGCTGTTGGGGG + Intergenic
1108174207 13:47775783-47775805 GACAGCCTACACTCTATACCTGG - Intergenic
1108854843 13:54780317-54780339 GAATGTTTACACTCTCTTGGTGG + Intergenic
1108983163 13:56546226-56546248 GAATGCTTATACACTATTGGTGG - Intergenic
1109986186 13:69988572-69988594 GAATGCTTACACTCTACTGGTGG - Intronic
1110488861 13:76079209-76079231 GAAAGCTTTTACACTATTGGTGG + Intergenic
1111027213 13:82544384-82544406 GAATGCTTATACTCTGTTGGTGG - Intergenic
1112065629 13:95789758-95789780 GAACGCTTATACACTATTGGTGG - Intronic
1112742508 13:102491041-102491063 GAGAGCTTACAGTCTAGTAGAGG - Intergenic
1114136092 14:19852861-19852883 GAACGCTTACACACTGTTGGAGG - Intergenic
1114310892 14:21466085-21466107 TGCAGCTTACAGTCTAGTGGGGG - Intronic
1114798097 14:25739805-25739827 GACAGCTTACACTGTATGCCTGG - Intergenic
1115339533 14:32277907-32277929 GATAGCCTACATTCTATTGGAGG - Intergenic
1116157479 14:41225321-41225343 GAAAGCTTATACACTTTTGGGGG + Intergenic
1116185290 14:41592744-41592766 GAATGCTTACACACTACTGGTGG + Intergenic
1116336118 14:43658787-43658809 GTCACCTTATAATCTATTGGTGG + Intergenic
1116337174 14:43671542-43671564 GAACACTTACACTCTGTTGGTGG + Intergenic
1116876816 14:50120510-50120532 GAAAGCTTACAATTTAATGGGGG - Intronic
1118056196 14:62081997-62082019 GAGAGCTTGCAGTCTAGTGGTGG + Intronic
1118415570 14:65532233-65532255 GAATGCTTACACACTGTTGGTGG - Intronic
1119607111 14:76029079-76029101 GAATGCTTACACACTGTTGGTGG - Intronic
1119731176 14:76952195-76952217 TAGAGCTTACATTCCATTGGAGG - Intergenic
1120212776 14:81650372-81650394 GAAATCTTACACTCTATTACAGG - Intergenic
1120338956 14:83194318-83194340 TACAACTTATATTCTATTGGTGG + Intergenic
1121482223 14:94287973-94287995 TGCAGCTTACATTCTATTGAAGG - Intronic
1124182459 15:27489487-27489509 GAAAGCTTTTACACTATTGGTGG - Intronic
1125225746 15:37393964-37393986 TACAGCTTATATTCTTTTGGGGG + Intergenic
1125896260 15:43304885-43304907 AGGAGCTTAGACTCTATTGGTGG + Intergenic
1126928683 15:53622155-53622177 AACAGCTTTTACACTATTGGTGG + Intronic
1127767778 15:62204360-62204382 GGAAGCTTATACACTATTGGTGG - Intergenic
1128260624 15:66230333-66230355 GAGGGCTTACAATCTAGTGGGGG - Intronic
1130290056 15:82591127-82591149 GAACGCTTACACACTGTTGGTGG - Intronic
1130405292 15:83594881-83594903 GACAGCTTATACACTGCTGGTGG + Intronic
1132308384 15:100835647-100835669 GAATGCTTACACACTGTTGGTGG - Intergenic
1133366890 16:5217206-5217228 GACAGAGTCCACTCTCTTGGGGG + Intergenic
1133489962 16:6258035-6258057 GAATGCTTACACACTGTTGGTGG - Intronic
1134376083 16:13675287-13675309 GACTGCTTATACACTGTTGGTGG - Intergenic
1135697832 16:24605658-24605680 GAACGCTCACACACTATTGGTGG + Intergenic
1136889615 16:33959496-33959518 GACAGCTTGCACTATATTTCTGG - Intergenic
1137625031 16:49902223-49902245 GAAAGCTTACACTCTGGTGGGGG + Intergenic
1137762805 16:50954170-50954192 AAGAGCTTACATTCTAATGGGGG - Intergenic
1138306781 16:55984570-55984592 GAAAGCTTATACACTGTTGGTGG - Intergenic
1203083451 16_KI270728v1_random:1164202-1164224 GACAGCTTGCACTATATTTCTGG + Intergenic
1143299308 17:5897986-5898008 ATGAGCTTACATTCTATTGGAGG + Intronic
1143328076 17:6113870-6113892 GAACTCTTATACTCTATTGGTGG + Intronic
1145109975 17:20154187-20154209 TAAAGTTTACACTCTAGTGGAGG + Intronic
1146157823 17:30538142-30538164 GAAAGCTTATACACCATTGGTGG - Intergenic
1146475770 17:33161590-33161612 AAGAGCTTACATTATATTGGTGG - Intronic
1147535621 17:41320558-41320580 GACCGCTTATACACTGTTGGTGG + Intergenic
1147913837 17:43874950-43874972 GAGTGCTTATACACTATTGGTGG - Intergenic
1148764248 17:50028168-50028190 GGCAGCTGACACTCTCCTGGAGG - Intergenic
1149427989 17:56573623-56573645 AACAGCCTGCACTCTATTTGAGG - Intergenic
1149499269 17:57139097-57139119 GAGAGCTTACAGTCCAATGGGGG - Intergenic
1151041922 17:70872790-70872812 TGGAGCTTACACTCTAATGGTGG + Intergenic
1151876955 17:76872228-76872250 GACATCTTACCATCTAGTGGTGG + Intronic
1155348449 18:24882256-24882278 AAGAGCTTACACTCTAGTGGTGG - Intergenic
1155464036 18:26115693-26115715 GAGAGCTTATACACTGTTGGTGG + Intergenic
1155624962 18:27824197-27824219 GACTGCTTATACACTGTTGGTGG + Intergenic
1155712205 18:28896683-28896705 GAACACTTACACACTATTGGTGG + Intergenic
1156238128 18:35224058-35224080 GATAGCTTATACACTGTTGGCGG + Intergenic
1156867016 18:41900113-41900135 GACTTCTTACAGTCCATTGGAGG - Intergenic
1156910157 18:42402642-42402664 GAACTCTTACACACTATTGGTGG - Intergenic
1157187161 18:45550468-45550490 GAGAGCTCACAGTCTAGTGGAGG - Intronic
1157851094 18:51051631-51051653 GTGAGCTTATACTCTAGTGGAGG + Intronic
1158205060 18:54983884-54983906 GACAGCAGACACTCTTGTGGGGG + Intergenic
1159626128 18:70696897-70696919 GAATGCTTACACACTATTGGTGG - Intergenic
1162623004 19:11859605-11859627 AACAACTTAAACTCTAGTGGGGG + Intronic
1163089373 19:15008439-15008461 GAAAGCTTATACACTGTTGGTGG + Intronic
1165345001 19:35240051-35240073 GAATGCTTACACACTGTTGGTGG - Intergenic
1165548717 19:36564626-36564648 GAATGCTTACACACTGTTGGTGG + Intronic
1168389198 19:55992479-55992501 GAAAGCTTATACACTGTTGGTGG - Intergenic
925512405 2:4642424-4642446 CACAGCTTACAATCTTTTGGGGG - Intergenic
925672201 2:6323253-6323275 GAAGGCTTATACACTATTGGTGG + Intergenic
926791559 2:16576655-16576677 GCAAGTTTACACTCTACTGGAGG - Intronic
927170582 2:20366261-20366283 GGGAGCTTACACTCTAGTGCAGG - Intergenic
928996679 2:37299913-37299935 GAATGCTTATACACTATTGGTGG + Intronic
929012800 2:37462158-37462180 GACAGCATATACTCTTTTGTCGG + Intergenic
929064247 2:37957267-37957289 GAAAGCTTTCACACTGTTGGTGG - Intronic
929367835 2:41182359-41182381 GAATGCTTACACACTGTTGGTGG - Intergenic
929637112 2:43534956-43534978 GAACTCTTACACCCTATTGGTGG - Intronic
933593120 2:84254989-84255011 GAAAGCTTATACACTGTTGGTGG - Intergenic
934843686 2:97647487-97647509 GGCAGCTTACACACTATTGTAGG - Intronic
935916030 2:107950761-107950783 GAATGCTTATACCCTATTGGTGG + Intergenic
936466270 2:112753968-112753990 TAGAGCTTACACTCTAGTGGAGG - Intronic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
938369368 2:130759699-130759721 GACAGCTCAGACTCTTTTGTGGG - Intronic
938566569 2:132524108-132524130 GACAGCTTTCCCTATAATGGTGG - Intronic
938990490 2:136623331-136623353 TAGAACTTACACTCTAGTGGGGG - Intergenic
940751760 2:157633885-157633907 GAACACTTACACACTATTGGTGG - Intergenic
941239910 2:163024544-163024566 GAATGCTTACACACTGTTGGTGG + Intergenic
941274889 2:163478758-163478780 GAATGCTTACACACTGTTGGTGG - Intergenic
941407589 2:165110205-165110227 TTAAGCTTACACTCTATTGGAGG - Intronic
941493321 2:166169699-166169721 GAATGCTTATACACTATTGGTGG + Intergenic
941636865 2:167944388-167944410 AGAAGCTTACACTATATTGGTGG + Intergenic
942846407 2:180431475-180431497 GACACCTCATACACTATTGGCGG + Intergenic
943489732 2:188535807-188535829 GAATGCTTATACACTATTGGTGG - Intronic
943776272 2:191769719-191769741 GAAAGCTTATACACTGTTGGTGG - Intergenic
944026327 2:195173354-195173376 GAACGCTTACACACTGTTGGTGG + Intergenic
944092670 2:195930555-195930577 GAATGCTTATACACTATTGGTGG + Intronic
944118355 2:196212806-196212828 GAATGCTTATACACTATTGGTGG - Intronic
944336601 2:198542019-198542041 GGCAGCTGAGACTCTGTTGGGGG - Intronic
944360941 2:198855868-198855890 GACAACTTATACACTGTTGGTGG + Intergenic
944391339 2:199222881-199222903 GAATGCTTATACTCTGTTGGTGG - Intergenic
944546176 2:200801229-200801251 GAATGCTTACACACTCTTGGTGG + Intergenic
944595814 2:201259577-201259599 GAAAGCTTATATTCTATTTGGGG + Intronic
944620764 2:201513459-201513481 GAATGCTTACACACTATTAGTGG + Intronic
944781670 2:203024603-203024625 GACAGTTTACATATTATTGGCGG + Intronic
945356833 2:208850235-208850257 GAATGCTTACACACTACTGGTGG - Intronic
946746541 2:222852194-222852216 GAAAGCTTTCACGCTGTTGGTGG + Intergenic
948343649 2:237277085-237277107 GAACACTTACACTCTGTTGGTGG + Intergenic
1170005285 20:11661975-11661997 GACTGCTTTTACACTATTGGTGG - Intergenic
1170041278 20:12042292-12042314 GAATGCTTATACACTATTGGTGG - Intergenic
1170868296 20:20180540-20180562 GAATGCTTATACTCTATTTGTGG + Intronic
1173230553 20:41192713-41192735 GACAGTGTACAGTCTTTTGGGGG + Intronic
1173307816 20:41867128-41867150 GAACACTTACACACTATTGGTGG - Intergenic
1174295739 20:49543802-49543824 CACAGCTGACACTCCAGTGGGGG - Intronic
1176977449 21:15338175-15338197 GAAACCTTGCACACTATTGGTGG + Intergenic
1177821436 21:26034861-26034883 GAGAGATTACATTCTATGGGGGG + Intronic
1179313422 21:40217613-40217635 GAATGCTTATACACTATTGGTGG - Intronic
1181728613 22:24828606-24828628 GAATGCTTACACACTTTTGGTGG + Intronic
1182116148 22:27757656-27757678 GACAGCTGCCACTCAACTGGGGG + Intronic
1182926761 22:34132403-34132425 AACAGCTTGCACACTAATGGGGG - Intergenic
1184956992 22:47895119-47895141 GAATGCTTATACACTATTGGTGG + Intergenic
949843350 3:8344358-8344380 GAAATCTTATACACTATTGGTGG - Intergenic
950233679 3:11298906-11298928 GAAAGCTGACACTATACTGGAGG - Intronic
950248626 3:11445082-11445104 GAACGCTTATACACTATTGGTGG + Intronic
951189956 3:19756554-19756576 TAGAGCTTATACACTATTGGTGG + Intergenic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
951890503 3:27563809-27563831 TAGAGCTTACATTCTACTGGTGG - Intergenic
953195585 3:40729953-40729975 GACAGCATATACTTGATTGGTGG + Intergenic
956395319 3:68819814-68819836 GAACGCTTACACACTGTTGGTGG + Intronic
957772779 3:84715983-84716005 GAATGCTTATACACTATTGGTGG + Intergenic
958589740 3:96140568-96140590 GAATGCTTATACACTATTGGTGG + Intergenic
958854493 3:99368103-99368125 GAAAGCTTATACCCTGTTGGTGG - Intergenic
959394143 3:105815577-105815599 GAATGCTTACACACTGTTGGTGG + Intronic
959668766 3:108950506-108950528 GAGACCTTACACACTGTTGGTGG - Intronic
959771094 3:110097241-110097263 GAATGCTTATACACTATTGGTGG - Intergenic
962007831 3:131365201-131365223 GAATGCTTACACAATATTGGTGG - Intergenic
962104974 3:132381064-132381086 GAATGCTTATACACTATTGGTGG - Intergenic
962645893 3:137439630-137439652 GACATCTTACATTTTAGTGGAGG - Intergenic
964112178 3:153099067-153099089 GAGAGCTTACATTCTAGAGGGGG - Intergenic
964120301 3:153176207-153176229 GAATGCTTACACACCATTGGTGG - Intergenic
964922984 3:161920443-161920465 GAATGCTTACACACTGTTGGTGG + Intergenic
964963828 3:162464206-162464228 GAATGCTTACACACTGTTGGTGG - Intergenic
965395077 3:168153039-168153061 GACAGCTTGCACTGTATTTGTGG + Intergenic
965808510 3:172567552-172567574 GAATGCTTATACTCTGTTGGTGG - Intergenic
965987035 3:174766820-174766842 GAGAGCTTACATTCTAGTAGGGG + Intronic
967122803 3:186398434-186398456 GAATGCTTATACACTATTGGTGG - Intergenic
967332706 3:188307715-188307737 GGGAGCTTACACTCTAGTGAGGG + Intronic
970125683 4:12807275-12807297 GAAAGCTTATACACTGTTGGTGG - Intergenic
970155443 4:13137009-13137031 GACAGCCTTCACTAAATTGGTGG - Intergenic
970668913 4:18373377-18373399 AAATGCTTACACACTATTGGTGG + Intergenic
970808518 4:20063958-20063980 GAAAGCTTTTACACTATTGGTGG + Intergenic
972136157 4:35897046-35897068 GAGTGCTTATACGCTATTGGTGG + Intergenic
973247816 4:48028946-48028968 GAATGCTTATACTCTGTTGGTGG + Intronic
973873459 4:55190044-55190066 GAGCACTTACACACTATTGGTGG + Intergenic
974241732 4:59258202-59258224 CACAGTTTACAGTCCATTGGAGG + Intergenic
974854797 4:67447819-67447841 GAAAGCTTATACACTGTTGGTGG + Intergenic
974997343 4:69177611-69177633 GAATGCTTTCACACTATTGGTGG + Intronic
975286229 4:72624226-72624248 GAATGCTTATACTCTGTTGGTGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976338012 4:83913071-83913093 TACAGGTTACGCTCTATTAGTGG - Intergenic
977076870 4:92464679-92464701 AGCAGCTTACAGTCTATTAGTGG + Intronic
979075253 4:116262513-116262535 TACAGCTTATCCACTATTGGTGG + Intergenic
980138231 4:128882647-128882669 GAGAGCTTGTACTCTGTTGGGGG + Intronic
980281879 4:130733639-130733661 AAATGCTTACACTCTATTGGTGG + Intergenic
980552637 4:134359740-134359762 GAACACTTACACACTATTGGTGG + Intergenic
980578453 4:134715973-134715995 GAAAGCTTTTACTCTGTTGGTGG + Intergenic
983981977 4:174008955-174008977 GAATGCTTATACACTATTGGTGG - Intergenic
984291546 4:177801450-177801472 CAAAGCTTACACACTATTGGCGG - Intronic
987613198 5:20235655-20235677 GAACGTTTACACACTATTGGTGG + Intronic
987878878 5:23715362-23715384 GAAAGCTTATACACTCTTGGTGG + Intergenic
987994141 5:25252955-25252977 GAATGCTTACACACTGTTGGTGG + Intergenic
988645367 5:33089733-33089755 GAATGCTTATACACTATTGGTGG - Intergenic
988862589 5:35299951-35299973 GAATGCTTACACACTGTTGGTGG - Intergenic
989311238 5:40021116-40021138 GAATGCTTACACACTGTTGGTGG - Intergenic
989680781 5:44027429-44027451 GAACACTTACACACTATTGGTGG - Intergenic
990790855 5:59477579-59477601 GACTGCTTATACGCTGTTGGTGG + Intronic
991208164 5:64073938-64073960 GAATGCTTACACACTGTTGGTGG - Intergenic
991238781 5:64431908-64431930 GAACTCTTATACTCTATTGGTGG + Intergenic
993240489 5:85377891-85377913 GAAAGCTCATACTCTGTTGGTGG - Intergenic
993303100 5:86238964-86238986 GAATGCTTCTACTCTATTGGTGG - Intergenic
993364290 5:87017944-87017966 GGAAGCTTACACACTGTTGGTGG - Intergenic
993465430 5:88240294-88240316 GAAAGCATATATTCTATTGGTGG - Intronic
993584257 5:89703428-89703450 GACAGCTTAAAGTTTAATGGAGG - Intergenic
993734940 5:91465140-91465162 GAATGCTTATACACTATTGGTGG + Intergenic
994262307 5:97674268-97674290 GAATGCTTATACACTATTGGTGG - Intergenic
994423109 5:99547336-99547358 GAATGCTTATACACTATTGGTGG + Intergenic
994927628 5:106138756-106138778 GAATGCTTATACACTATTGGTGG - Intergenic
994964493 5:106651680-106651702 GAATGCTTTCACACTATTGGTGG - Intergenic
995211558 5:109545341-109545363 GAATGCTTATACACTATTGGTGG - Intergenic
995319159 5:110812071-110812093 GAATGCTTACACACTGTTGGTGG + Intergenic
995791384 5:115891745-115891767 GACAGCTTGCACTGTATTCCTGG + Intronic
995842807 5:116459805-116459827 GACAGCTTACAGTTTAGTGAGGG - Intronic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
996696084 5:126396787-126396809 GACTGCTTAGACACTGTTGGTGG - Intronic
997326434 5:133025876-133025898 GAGAGCTTACATTCTAGTGATGG - Intronic
997774638 5:136590649-136590671 GAGTGCTTATACACTATTGGTGG - Intergenic
998210570 5:140194219-140194241 CACAGCCTACAGTCTAGTGGAGG + Intronic
998754732 5:145364467-145364489 GGGAGCTTACATTCTAATGGAGG - Intergenic
999851732 5:155547702-155547724 GAATGCTTACACACTGTTGGTGG - Intergenic
1000134383 5:158331978-158332000 GAAAGCTTACACACTGTTAGTGG - Intergenic
1000460637 5:161513108-161513130 GAACGCTTACACACTGTTGGTGG + Intronic
1000709694 5:164556799-164556821 GAATGCTTACACACTGTTGGTGG - Intergenic
1001393763 5:171402384-171402406 GAATGCTTACACACTCTTGGTGG + Intronic
1004031439 6:11873959-11873981 GACAGTTTACCTTCTAGTGGGGG + Intergenic
1004171066 6:13295951-13295973 GACAGCTCATATTCTAATGGTGG - Intronic
1004872269 6:19918799-19918821 GAATGCTTACACACTGTTGGTGG + Intergenic
1005264285 6:24095020-24095042 GAATGCTTACACACTGTTGGTGG - Intergenic
1005427272 6:25715919-25715941 AAGAGCTTACAGTCTGTTGGAGG + Intergenic
1006062787 6:31437637-31437659 GACAGCAGATACTCGATTGGTGG + Intergenic
1006689225 6:35866240-35866262 GACTTCTTACACACTCTTGGTGG + Intronic
1007199836 6:40098015-40098037 GACAGCATACACTATATTCTTGG + Intergenic
1007888657 6:45263017-45263039 GAAAGCTTACACACTGCTGGTGG + Intronic
1007995299 6:46301579-46301601 GTAGGCTTACACTCTACTGGTGG + Intronic
1008264380 6:49406495-49406517 TTCAGCTTACACTCTATTGAGGG - Intergenic
1009615820 6:66005210-66005232 GAAATCTTACACACTGTTGGGGG - Intergenic
1009679214 6:66870373-66870395 GAAAGCTTTCACACTGTTGGTGG - Intergenic
1009723679 6:67508203-67508225 GTCAGCTTTAACTCTACTGGAGG + Intergenic
1010272621 6:73931382-73931404 GAACGCTTATACACTATTGGTGG - Intergenic
1010273786 6:73945810-73945832 GAATGCTTATACACTATTGGTGG - Intergenic
1010336665 6:74692562-74692584 GAAGGCTTATACACTATTGGTGG + Intergenic
1010491582 6:76483093-76483115 GAAAGCTTATACACTGTTGGTGG + Intergenic
1010522595 6:76858057-76858079 GAATGCTTACACACTGTTGGTGG - Intergenic
1011402385 6:86977639-86977661 GAACGCTTACACACTGTTGGTGG - Intronic
1011890918 6:92158798-92158820 AAGAGCTTACACTCTACTTGGGG + Intergenic
1012917830 6:105189704-105189726 GACTGCTTAGTATCTATTGGAGG - Intergenic
1012951992 6:105528119-105528141 GAACGCTTACACACTGTTGGTGG + Intergenic
1013517709 6:110903650-110903672 GAAAGCTTACATTCTAGTAGAGG - Intergenic
1013670960 6:112401987-112402009 GAACACTTACACACTATTGGTGG - Intergenic
1013879852 6:114884054-114884076 GAATGCTTATACACTATTGGTGG + Intergenic
1013905473 6:115212108-115212130 GAAAGCTTACATACTGTTGGTGG + Intergenic
1014877927 6:126684271-126684293 GAATGCTTATACACTATTGGCGG + Intergenic
1015395827 6:132733558-132733580 GAACACTTACACACTATTGGTGG + Intronic
1017762113 6:157577475-157577497 GACTGCTTATACACTGTTGGTGG - Intronic
1018416270 6:163604877-163604899 GACAGCTTGCACTGTATTCCTGG + Intergenic
1020674180 7:11160508-11160530 GAATGCTTATACACTATTGGTGG - Intronic
1021125691 7:16849410-16849432 GACAGTTTATACACTGTTGGTGG - Intergenic
1021204247 7:17760426-17760448 GAATGCTTACACACCATTGGTGG + Intergenic
1021583814 7:22186547-22186569 GAAGGCTTATATTCTATTGGAGG - Intronic
1021990490 7:26136805-26136827 GACAGATGGCATTCTATTGGGGG + Intergenic
1022485771 7:30776531-30776553 GGGAGCTTGCACTCTATAGGGGG - Intronic
1022734946 7:33066972-33066994 GAATGCTTAAACACTATTGGTGG + Intergenic
1024199625 7:47092577-47092599 GAACTCTTACACACTATTGGTGG + Intergenic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1026460462 7:70610364-70610386 GAAAGCTTACATGCTGTTGGTGG - Intronic
1027429635 7:78097193-78097215 GAAAGCTTATACACTATTGGTGG + Intronic
1028185477 7:87780240-87780262 GAATGCTTACACTCTGTTGATGG - Intronic
1028713918 7:93942018-93942040 GAAAGCTTATACACTGTTGGAGG - Intergenic
1028745262 7:94320244-94320266 GACAGCTTACACTCTGTGCCTGG - Intergenic
1028814400 7:95128126-95128148 GAATGCTTACACGCTGTTGGTGG - Intronic
1028814696 7:95130595-95130617 GACAGCTTGCACTCTATGCCTGG + Intronic
1028881913 7:95889974-95889996 GAATGCTTACACACTGTTGGTGG + Intronic
1029023314 7:97388161-97388183 GACTGCTTATACACTATTGGTGG + Intergenic
1029931378 7:104374782-104374804 AAAAGCTTACACTCTGGTGGAGG - Intronic
1030702423 7:112656058-112656080 GAATGCTTACACACTGTTGGTGG - Intergenic
1030731859 7:112999511-112999533 GAAAACTTATACACTATTGGTGG + Intergenic
1031049902 7:116934603-116934625 TGCAGCTGACACTCTATTAGAGG - Intergenic
1031476991 7:122235535-122235557 GACTGCTTACACACTGTTGGTGG + Intergenic
1031684531 7:124716778-124716800 GAATGCTTACATACTATTGGTGG + Intergenic
1031909667 7:127502362-127502384 GAAAACTTATACACTATTGGTGG + Intergenic
1031911597 7:127522592-127522614 GAACACTTACATTCTATTGGTGG + Intergenic
1032805970 7:135354536-135354558 AAAAGCTTACAGTCTAGTGGAGG + Intergenic
1032927695 7:136627350-136627372 GAATCCTTGCACTCTATTGGTGG - Intergenic
1033093217 7:138405836-138405858 GACAGATTACACACTATAGCAGG - Intergenic
1033438503 7:141356329-141356351 GAAAGCTTATACACTATTTGTGG - Intronic
1034205690 7:149312504-149312526 GAATGCTTATACACTATTGGTGG - Intergenic
1034817802 7:154188451-154188473 GACAAATTACAATCTAGTGGGGG + Intronic
1035103720 7:156423223-156423245 GAATGCTTACACACTCTTGGTGG - Intergenic
1035493178 7:159297714-159297736 GAATGCTTGCACACTATTGGTGG - Intergenic
1036467322 8:9012912-9012934 CACAGCTTAAACTTTATTGAAGG - Intronic
1036707684 8:11057314-11057336 GCAAGCTTACATTCTAGTGGGGG - Intronic
1037085858 8:14849204-14849226 AACTTCTTACACTCTACTGGTGG + Intronic
1038904226 8:31880062-31880084 GAACCCTTACACACTATTGGTGG + Intronic
1039442683 8:37606019-37606041 AACAGCTTACAGTCTAGTTGAGG + Intergenic
1039677781 8:39688822-39688844 GAATGCTTACACACTATTAGTGG - Intronic
1041664845 8:60433402-60433424 GAAAGCTTATACACTGTTGGTGG - Intergenic
1042109079 8:65360076-65360098 GACAGCTCACAGTCTAGTAGAGG - Intergenic
1042405438 8:68399770-68399792 GAACGCTTACACACTGTTGGTGG - Intronic
1042672859 8:71283423-71283445 GGGAACTTACATTCTATTGGAGG - Intronic
1042952690 8:74218214-74218236 AGCAGCTTACACTCTAGTGAAGG - Intergenic
1043038416 8:75228272-75228294 GGGAGCTTACATTCTAGTGGAGG + Intergenic
1043059001 8:75476408-75476430 GAATGCTTATACCCTATTGGTGG - Intronic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1044918741 8:97145646-97145668 GACTGCTTATACACTATTGGTGG - Intronic
1045411061 8:101919912-101919934 GAATGCTTACACACTGTTGGTGG + Intronic
1045868712 8:106900555-106900577 GAATGCTTATACTCTGTTGGAGG - Intergenic
1046267386 8:111847892-111847914 GAAAACTTACACACTGTTGGTGG - Intergenic
1047081310 8:121464469-121464491 GAATGCTTACACACTGTTGGTGG - Intergenic
1047812505 8:128425801-128425823 GACAGCTTCCATTCTAATAGGGG - Intergenic
1048526057 8:135203972-135203994 GAATGCTTACACACTGTTGGTGG + Intergenic
1050003990 9:1108783-1108805 GAGAGCTTTCACACTGTTGGTGG - Intergenic
1050425393 9:5507846-5507868 GAATGCTTATACACTATTGGTGG + Intergenic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1050679883 9:8098536-8098558 GAATGCTTACACACTATTGGTGG - Intergenic
1050836901 9:10093477-10093499 GAATGCTTATACTCTGTTGGTGG + Intronic
1051108121 9:13603854-13603876 GACAGCATGCAATCTGTTGGAGG + Intergenic
1051208615 9:14716987-14717009 TAGAGCTTACATTCTATTGGGGG - Intergenic
1051216169 9:14800123-14800145 GAAAGCTTACACACTAGTTGGGG + Intronic
1052394373 9:27921166-27921188 GAATGCTTATACTCTATTGGTGG + Intergenic
1055183321 9:73417591-73417613 GAAAGATTACATACTATTGGGGG - Intergenic
1057556338 9:96091078-96091100 GAACACTTACACTCTGTTGGTGG - Intergenic
1058801253 9:108546331-108546353 GACAACTAACAATCTCTTGGAGG + Intergenic
1059623489 9:116035174-116035196 GAGAGCTTACAATTTAATGGAGG + Intergenic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1185665917 X:1765486-1765508 GACAGCTTCCACTCTTTGGAAGG - Intergenic
1186498503 X:10031924-10031946 GGCAGCTCACTCTCTATGGGGGG - Intronic
1187874980 X:23796620-23796642 GTCAGCTAACACTCCGTTGGTGG - Intergenic
1188104769 X:26136776-26136798 GAATGCTTACACACTGTTGGTGG + Intergenic
1188139240 X:26527947-26527969 GAAAGCTTATACACTGTTGGTGG - Intergenic
1188413633 X:29904983-29905005 GAATGCTTTCACTCTGTTGGTGG - Intronic
1189678846 X:43492860-43492882 GAAAGCTTATACACTGTTGGTGG + Intergenic
1189881560 X:45498764-45498786 GAATGCTTACACACTGTTGGTGG - Intergenic
1191916940 X:66211946-66211968 GAACTCTTACACACTATTGGTGG - Intronic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1192675330 X:73190126-73190148 GAAAGCTTTTACACTATTGGTGG + Intergenic
1192759813 X:74085642-74085664 GACAGCACACAGTCTCTTGGGGG - Intergenic
1192981339 X:76346508-76346530 GAATGCTTACAAACTATTGGTGG - Intergenic
1193527055 X:82605077-82605099 GACTGCTTATACACTGTTGGTGG + Intergenic
1193843500 X:86438812-86438834 GAATGCTTATACACTATTGGTGG - Intronic
1193978645 X:88154765-88154787 GAGAGCTTACATTCTATTTAGGG - Intergenic
1194755193 X:97731199-97731221 GAGAGCTTACATTTTAGTGGAGG + Intergenic
1194785409 X:98077928-98077950 GAATGCTTATACACTATTGGTGG - Intergenic
1194918443 X:99733497-99733519 GACTGTTTATACACTATTGGTGG - Intergenic
1195009461 X:100721407-100721429 TACAGCTTACAATCTAGTGGGGG - Intronic
1195390728 X:104359392-104359414 GACGGCTTACAATGTCTTGGAGG + Intergenic
1195534721 X:105998303-105998325 GAATGCTTACACACTGTTGGTGG + Intergenic
1196006902 X:110846366-110846388 GAATGCTTACACACTGTTGGTGG + Intergenic
1196010594 X:110883437-110883459 GAATGCTTATACGCTATTGGTGG - Intergenic
1196044117 X:111238540-111238562 GAATGCTTATACTCTGTTGGTGG - Intergenic
1196477028 X:116099498-116099520 GAATGCTTACACACTGTTGGTGG - Intergenic
1196577302 X:117334335-117334357 AGCAGCTCACAGTCTATTGGAGG - Intergenic
1196896651 X:120343556-120343578 GAACACTTACACACTATTGGTGG - Intergenic
1197712722 X:129683440-129683462 TGAAGCTTACACTCTAGTGGGGG + Intergenic
1198039791 X:132839008-132839030 GAAAGCTTATACACTGTTGGTGG + Intronic
1198405111 X:136304626-136304648 GGAAGCTTACACTCTAGTAGGGG + Intronic
1199654153 X:149978199-149978221 TATAGCTTACATTCTAGTGGGGG - Intergenic
1199889000 X:152056246-152056268 GAACACTTACACACTATTGGTGG - Intergenic
1199909836 X:152273317-152273339 GAAAGCTTATACACTGTTGGTGG + Intronic
1199945565 X:152663573-152663595 GAATGCTTATACACTATTGGTGG - Intergenic
1201666509 Y:16462901-16462923 GAAAGCTTATACACTATTGATGG + Intergenic