ID: 1065284074

View in Genome Browser
Species Human (GRCh38)
Location 10:24170409-24170431
Sequence CAAATTTCACACAATGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065284074_1065284081 30 Left 1065284074 10:24170409-24170431 CCAAGCTCATTGTGTGAAATTTG 0: 1
1: 0
2: 0
3: 15
4: 263
Right 1065284081 10:24170462-24170484 CTGTGAAATATTGAGTCAGTGGG No data
1065284074_1065284078 7 Left 1065284074 10:24170409-24170431 CCAAGCTCATTGTGTGAAATTTG 0: 1
1: 0
2: 0
3: 15
4: 263
Right 1065284078 10:24170439-24170461 TGGGAACTTCATTATTTTCCTGG No data
1065284074_1065284080 29 Left 1065284074 10:24170409-24170431 CCAAGCTCATTGTGTGAAATTTG 0: 1
1: 0
2: 0
3: 15
4: 263
Right 1065284080 10:24170461-24170483 GCTGTGAAATATTGAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065284074 Original CRISPR CAAATTTCACACAATGAGCT TGG (reversed) Intronic
901096460 1:6684239-6684261 AAAAATTCAAACAATTAGCTGGG - Intronic
901518683 1:9767003-9767025 GAATGTTCACACAGTGAGCTGGG + Intronic
901652877 1:10753132-10753154 TAAATTTCACACAAATAGCACGG - Intronic
902453566 1:16515167-16515189 CAAATTTGACACAAATACCTGGG + Intergenic
902473621 1:16667831-16667853 CAAATTTGACACAAATACCTGGG + Intergenic
902485182 1:16739611-16739633 CAAATTTGACACAAATACCTGGG - Intergenic
902498916 1:16895094-16895116 CAAATTTGACACAAATACCTGGG - Intronic
903373404 1:22851153-22851175 AAAATTTTAAAAAATGAGCTGGG - Intronic
905534686 1:38711997-38712019 CTAATTTCATAAAATGAGTTGGG - Intergenic
906133926 1:43481867-43481889 GAAATTTCAAAAAATTAGCTTGG - Intergenic
906391868 1:45424409-45424431 CAAATCTCACTCAGTGATCTAGG - Intronic
906970064 1:50503458-50503480 AAAATTTAAAACAATTAGCTGGG + Intronic
908201704 1:61802817-61802839 CAACTGTTACTCAATGAGCTTGG - Intronic
908597563 1:65704873-65704895 TAAATTTCAATCAAAGAGCTTGG - Intergenic
911212064 1:95152290-95152312 CAAAATGCACAAAATGACCTGGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
914005687 1:143730497-143730519 CAAATTTGACACAAATACCTGGG + Intergenic
914098153 1:144561743-144561765 CAAATTTGACACAAATACCTGGG + Intergenic
914300828 1:146375873-146375895 CAAATTTGACACAAATACCTGGG - Intergenic
914504669 1:148278539-148278561 CAAAATACAAAAAATGAGCTGGG + Intergenic
915377865 1:155413444-155413466 AAAATTACAAACAATTAGCTGGG + Intronic
915747905 1:158179311-158179333 CAAATTACACATAATTAGATAGG + Intergenic
917005543 1:170412609-170412631 CAAGCTTCACAAAATGAGTTGGG - Intergenic
917959984 1:180134429-180134451 CAAGTTTCCCAAAAGGAGCTGGG + Intergenic
917983676 1:180293226-180293248 CTGGTTTCACAGAATGAGCTGGG + Intronic
918780324 1:188691549-188691571 CAAATTTCACAGTAAGAGGTAGG - Intergenic
919843223 1:201623976-201623998 CAAATGTCCCACAATGAATTGGG - Intronic
920063211 1:203243226-203243248 CAAATCTCACAGAATAAGTTAGG - Intronic
921141378 1:212310238-212310260 CAAATATCACATACTGACCTTGG - Intronic
921343426 1:214156974-214156996 CAAGTGTCAGACAATGTGCTAGG + Intergenic
922412343 1:225388920-225388942 AAAAATACAAACAATGAGCTGGG - Intronic
922931032 1:229389892-229389914 CAAAATACAGACATTGAGCTAGG + Intergenic
924843023 1:247734475-247734497 TTAATTTAACAAAATGAGCTTGG + Intergenic
1065284074 10:24170409-24170431 CAAATTTCACACAATGAGCTTGG - Intronic
1065297572 10:24291231-24291253 AAAATTTCACTCAATCGGCTGGG + Intronic
1065516282 10:26527384-26527406 CAAAAATCAAACAATTAGCTGGG + Intronic
1065600441 10:27362603-27362625 CAAATTTAATACAATTAGTTTGG + Intergenic
1068271875 10:54738159-54738181 CAAATTTCTCAAAATGTCCTAGG - Intronic
1069220071 10:65872170-65872192 CAAATTTGAAACAATAAGTTAGG - Intergenic
1070869182 10:79733646-79733668 CAAGGTTCACACATTGAGATTGG + Intergenic
1071636096 10:87255823-87255845 CAAGGTTCACACATTGAGATTGG + Intergenic
1071659145 10:87482123-87482145 CAAGGTTCACACATTGAGATTGG - Intergenic
1072232885 10:93427893-93427915 AAAATTTCAAACAATTTGCTAGG + Intronic
1072282792 10:93884324-93884346 CAAATTACAAAAAATTAGCTGGG - Intergenic
1073419292 10:103411235-103411257 CAAATTTCCTACAATGAACATGG + Intronic
1074880537 10:117654173-117654195 CAAAGGTCACACAATGAGTTAGG + Intergenic
1077388632 11:2288537-2288559 CAAATTTCACACAAGGTGCCTGG - Intergenic
1077745757 11:4902833-4902855 GAAATTTAAAACAATGAGCAGGG - Intronic
1078086966 11:8239680-8239702 CAAATGTCTCACCCTGAGCTGGG - Intronic
1078510893 11:11983199-11983221 CAAATTTAAGAGACTGAGCTAGG - Intronic
1078607823 11:12792758-12792780 AAAATGTTACAAAATGAGCTGGG + Intronic
1079675084 11:23217120-23217142 GAAATTTCCCACAAGGAGCTGGG + Intergenic
1079855494 11:25598082-25598104 CAAATATCACACAATAAACATGG - Intergenic
1081372550 11:42321789-42321811 CAGATCTCACATAATGTGCTGGG - Intergenic
1085419547 11:76343768-76343790 CAAGCTTCTCTCAATGAGCTTGG + Intergenic
1085452763 11:76645611-76645633 CAAATTTCACAAAATGCCCCTGG - Intergenic
1088340465 11:108759928-108759950 CAAATTCAACACAATGAAGTAGG - Intronic
1092573806 12:9756514-9756536 GAAATTTCATATAATGAGATAGG - Intronic
1093315870 12:17648697-17648719 AAAATTTCACAGAATGGGCCAGG - Intergenic
1095279406 12:40332808-40332830 CAAATTTTACACCATGTGTTTGG + Intronic
1095750072 12:45700277-45700299 CAAATTTCAGACCATGACCTTGG - Intergenic
1098075015 12:66719923-66719945 CCAATATCACACAATGAGTTTGG + Intronic
1099633551 12:85181742-85181764 CAGATTCCTCACAATGAGATAGG - Intronic
1100546864 12:95611748-95611770 CAATATTCACAAAATCAGCTTGG - Intergenic
1101833994 12:108282265-108282287 CAAATTTCAGACAAAGATCATGG - Intergenic
1101860638 12:108479686-108479708 CAACGTGCACACAATCAGCTGGG + Intergenic
1107138591 13:36972829-36972851 AAAAATTCACAAAATTAGCTGGG + Intronic
1108239649 13:48449599-48449621 AAAATTTCAGAAAATTAGCTGGG + Intronic
1109575892 13:64258220-64258242 CAAATTTTAAAAAATTAGCTAGG + Intergenic
1112653343 13:101421938-101421960 AAAAATTCAAACAATTAGCTAGG + Intergenic
1114188131 14:20419167-20419189 AAAAATACAAACAATGAGCTGGG - Intergenic
1115853460 14:37605284-37605306 CAAATTTTAGACAACGAGTTTGG + Intronic
1116923808 14:50611700-50611722 CATATTGAACACAATGGGCTAGG + Intronic
1117018876 14:51549153-51549175 AACATTTCATACACTGAGCTAGG - Intronic
1121904999 14:97731636-97731658 TAAACTTCACACAATCAGGTAGG + Intergenic
1121979963 14:98446101-98446123 CTAAAGTCACACAGTGAGCTGGG - Intergenic
1123436286 15:20256992-20257014 AAAAATTCACAAAATTAGCTGGG - Intergenic
1125418616 15:39479415-39479437 CCAAGTTTAGACAATGAGCTCGG + Intergenic
1127352398 15:58166398-58166420 GACATTTCACACAATGATCTAGG - Intronic
1128083436 15:64870328-64870350 CAAATCTCACCCAAGGACCTTGG + Intronic
1129919309 15:79306300-79306322 ATAATTTCAAACAGTGAGCTTGG - Intergenic
1130508074 15:84565411-84565433 AAAAATACAAACAATGAGCTAGG + Intergenic
1131947147 15:97636021-97636043 CAAATTTCAACCTATGGGCTTGG - Intergenic
1131972959 15:97910807-97910829 TAAATATCACACAAGGGGCTAGG - Intergenic
1134827095 16:17293646-17293668 AAAATTACAAACAATTAGCTGGG - Intronic
1137991942 16:53166363-53166385 CAAATTTCTCACCAATAGCTGGG - Intronic
1140573005 16:76130590-76130612 CAAAATTTATACAATTAGCTGGG - Intergenic
1141120935 16:81355522-81355544 CAAAAATCAAACAATTAGCTAGG - Intronic
1143607638 17:7998727-7998749 CAAATTTCAAAAAATTAGCCAGG + Intergenic
1143613764 17:8037473-8037495 CAAAGTTCAGTCAATGAGGTAGG - Intergenic
1149119207 17:53141071-53141093 CAATTTTAACACAAAGAGTTAGG - Intergenic
1150234628 17:63583033-63583055 CAGGTTTCACAGAATCAGCTTGG + Intronic
1150734224 17:67722657-67722679 GAAATTTCACAAAATGGGCCAGG - Intronic
1151084682 17:71366681-71366703 CAAATTTCATGCAGTGAGCCTGG - Intergenic
1151887958 17:76934235-76934257 TAACCTTCACACAATGAGGTAGG + Intronic
1151905843 17:77048534-77048556 CAAATTTCAAACATTCAGCTGGG + Intergenic
1153187515 18:2501606-2501628 CAAATTTTAAAAAATTAGCTGGG - Intergenic
1153616349 18:6938211-6938233 TAAATGTCACACAATGCCCTGGG - Intergenic
1156807554 18:41203909-41203931 CTAACTTCACACAATGACATGGG - Intergenic
1158563446 18:58534615-58534637 CAAATTTCACACACTGGGGGAGG + Intronic
1158860553 18:61588066-61588088 GTAATTTCACACAATGACCCTGG + Intergenic
1160461944 18:79046216-79046238 CAAATATCTCACAATGAGGTGGG + Intergenic
1160577490 18:79864647-79864669 CAAATGTCACACAATTCTCTAGG - Intronic
1160920171 19:1515912-1515934 CAAATTGCAGACACTGGGCTGGG + Intergenic
1161404443 19:4083796-4083818 AAAGTTTCAAAAAATGAGCTGGG + Intergenic
1162045672 19:7998629-7998651 CTAATTTTAAAAAATGAGCTGGG - Intronic
1163239090 19:16048192-16048214 AAAAATTCACAAAATTAGCTGGG + Intergenic
1163299649 19:16435990-16436012 CAAAGTCCACACAATGCGCTGGG + Intronic
1165238465 19:34443389-34443411 AAAGTTTAACACAATGTGCTTGG - Intronic
1166648805 19:44554239-44554261 AAAATTTCAAAAAATTAGCTGGG + Intergenic
1202705812 1_KI270713v1_random:22906-22928 CAAATTTGACACAAATACCTGGG + Intergenic
925854398 2:8115968-8115990 TAAATTACACACAGTGAACTTGG - Intergenic
926025477 2:9539557-9539579 CAAATTTAATGCAATGATCTTGG + Intronic
928169341 2:28993439-28993461 CAAACTTCACCCCCTGAGCTAGG - Intronic
928323476 2:30302056-30302078 CAATTATGACACAATGAGCCTGG - Intronic
929142722 2:38680454-38680476 CTAGAGTCACACAATGAGCTAGG + Intronic
929268206 2:39942379-39942401 CAAAGTCCACACAATGGGCTAGG - Intergenic
929377903 2:41312944-41312966 CATATTTCACACCATGAAGTTGG + Intergenic
929485392 2:42348755-42348777 AAAATTACAAACAATTAGCTGGG + Intronic
929796104 2:45059351-45059373 TATATGTCAGACAATGAGCTGGG + Intergenic
929941766 2:46339536-46339558 TAAATTTCACACAGTAGGCTAGG - Intronic
929992858 2:46804153-46804175 TAAATGTCACACGGTGAGCTGGG - Intergenic
930342657 2:50136282-50136304 CAAATTGTTCAAAATGAGCTGGG + Intronic
934308889 2:91845885-91845907 AAAATTTCACAAAATTAGCAGGG - Intergenic
935846594 2:107172469-107172491 CAAAATTCACAAGATGAGCCTGG - Intergenic
936286956 2:111188216-111188238 CAAATTGCACACAAAAACCTGGG + Intergenic
936450396 2:112629620-112629642 AAAAATTCAAAAAATGAGCTGGG + Intergenic
936778120 2:115998687-115998709 CAAAAATTACACAATTAGCTGGG + Intergenic
938781659 2:134590160-134590182 TAAATTTCATAGAATTAGCTTGG - Intronic
940097089 2:149989279-149989301 CATATGTCAGACAATGTGCTTGG - Intergenic
940267029 2:151849568-151849590 CAAAATACTCACAAAGAGCTGGG - Intronic
940412277 2:153379168-153379190 CAAGTTTTTCAAAATGAGCTTGG - Intergenic
942020568 2:171863976-171863998 TAAATTTCACACACTGTGCAAGG + Intronic
944181454 2:196899875-196899897 AAAATTTCAAAAAATTAGCTGGG + Intronic
947061414 2:226170676-226170698 GCAATTTCAAACAATCAGCTGGG - Intergenic
1169416059 20:5417184-5417206 AAAAAATCACACAATTAGCTAGG + Intergenic
1170354169 20:15474335-15474357 GAAATTTCACTTAATGAGCGAGG + Intronic
1172039527 20:32034341-32034363 CCAAGGTCACACAGTGAGCTGGG + Intergenic
1172198455 20:33108352-33108374 CAAATTTCAGATATTGAGCACGG - Intronic
1173108449 20:40161209-40161231 CAAATATATCACAGTGAGCTGGG + Intergenic
1174337433 20:49873184-49873206 CAAAATCCACACATTTAGCTGGG + Intronic
1174708686 20:52682988-52683010 AAAAATTCAAACAATTAGCTGGG + Intergenic
1175025377 20:55896239-55896261 CAAATTTTAAAAAATTAGCTAGG - Intergenic
1176926038 21:14750107-14750129 CAAGTTTCAGAGAATGAACTGGG + Intergenic
1181682159 22:24502870-24502892 CAAAGTTGACAAAATGGGCTGGG - Intronic
949136025 3:566537-566559 CAAAATACACAAAATTAGCTGGG + Intergenic
950160591 3:10757872-10757894 CATATTTGACACATTGAGGTAGG + Intergenic
950804788 3:15590672-15590694 CACATTTTACACACTGAGCTTGG + Intronic
952176042 3:30864493-30864515 CATAATTCACACAATTATCTAGG + Intronic
952450203 3:33424882-33424904 AAAATTACACAAAATTAGCTGGG + Intronic
953107115 3:39893556-39893578 CAATTTTCTCACAATGAACATGG - Intronic
954192294 3:48972316-48972338 CAAATTTAAAAAAATTAGCTGGG - Intronic
954770995 3:52968749-52968771 CAAAATACAAACAATTAGCTGGG - Intronic
955020204 3:55113175-55113197 CAATTTTCACAAAAGTAGCTGGG - Intergenic
957952847 3:87147417-87147439 CCATTTTCACACAATGAGAGCGG + Intergenic
958020526 3:87989511-87989533 CTAATTTCATACAATGATCATGG + Intergenic
958078183 3:88711147-88711169 AAAATTTCAAAGAATGAGGTTGG + Intergenic
961936174 3:130586113-130586135 AAAATTTTACAAAATTAGCTGGG - Intronic
962380251 3:134892815-134892837 CAAATTACACACCAAGAGTTAGG - Intronic
962534821 3:136318182-136318204 CAAAATACAAAAAATGAGCTGGG + Intronic
962614836 3:137114959-137114981 CAAACTTCATAAAATGAGTTGGG + Intergenic
962800882 3:138889551-138889573 AAAATATCAAACAATTAGCTGGG + Intergenic
963932704 3:151020615-151020637 CAAATCTCAGACAATGAGGAGGG - Intergenic
964664079 3:159152656-159152678 CAAGTTTAACACAATAACCTAGG - Intronic
965491667 3:169344751-169344773 CAAATTTCAGACAGTGGCCTTGG - Intronic
965699346 3:171443664-171443686 AAAATTTCAAAAAATTAGCTGGG + Intronic
966482303 3:180424548-180424570 TAAATGTCACACAATGCCCTGGG + Intergenic
968496189 4:917984-918006 CTAACTTCAAGCAATGAGCTGGG - Intronic
970140150 4:12973464-12973486 CAACCTTTGCACAATGAGCTGGG + Intergenic
970502884 4:16696186-16696208 CAATTTTCACACCATCATCTGGG + Intronic
971847851 4:31943935-31943957 CCAATTTCAAATAATGAACTTGG + Intergenic
972445419 4:39138984-39139006 CAAACTGCACACCATCAGCTGGG + Intergenic
973241190 4:47957322-47957344 CAAAAATCACACACTGAGCATGG + Intronic
974313129 4:60239106-60239128 CAAAATACACAAAATGAGCCGGG + Intergenic
976022856 4:80651524-80651546 CAAAATTCAAAAAATTAGCTAGG - Intronic
976685460 4:87809540-87809562 GATATTTGACACAATTAGCTTGG + Intronic
977099225 4:92788080-92788102 GGAATTTCAAACCATGAGCTTGG + Intronic
979568033 4:122179117-122179139 AAAATTTTAAAAAATGAGCTGGG + Intronic
982751676 4:159169542-159169564 CAAATGACACAAAATTAGCTAGG - Intronic
983867659 4:172788202-172788224 CAAAAAACACACAATTAGCTGGG + Intronic
984339428 4:178436569-178436591 CAACTTTCACACAAACACCTGGG + Intergenic
986936138 5:12889488-12889510 AAAATGTTACAGAATGAGCTTGG - Intergenic
987157527 5:15105305-15105327 CAAAGTTCACACATTGCACTTGG - Intergenic
989490839 5:42050803-42050825 CAAATTACACTCAACCAGCTAGG - Intergenic
989815091 5:45726519-45726541 CAAATTTCTCACAGTTAGTTAGG + Intergenic
990383883 5:55240498-55240520 CAAAAATCACAAAATTAGCTGGG + Intergenic
991934352 5:71787157-71787179 CAAATTTCAGACCAAGAGCTGGG - Intergenic
994140843 5:96339509-96339531 CTAAAATCACACAGTGAGCTGGG + Intergenic
994680254 5:102877867-102877889 AAAATTTAAAACAATTAGCTGGG + Intronic
997482815 5:134201252-134201274 AAAATTTTAAAAAATGAGCTGGG + Intronic
997526284 5:134555180-134555202 CAGATTTCAGACCATGAGGTGGG - Intronic
997933738 5:138092727-138092749 CTAATTTAAAACAATAAGCTAGG - Intergenic
998131646 5:139654342-139654364 CAAATGTCACACATCCAGCTAGG - Intronic
999862815 5:155666806-155666828 CAAGCTACACAGAATGAGCTTGG + Intergenic
1001190345 5:169624673-169624695 CTAATCTCATAAAATGAGCTAGG + Intergenic
1001268755 5:170295069-170295091 CTAAGGTCACACAGTGAGCTGGG + Intronic
1003065275 6:2899687-2899709 CCTTCTTCACACAATGAGCTGGG + Intronic
1004051751 6:12088378-12088400 CAAATTTAACACACTGGTCTAGG - Intronic
1004095354 6:12548778-12548800 CTGTTTTCACAAAATGAGCTTGG + Intergenic
1005857485 6:29873532-29873554 CTACTTTCACACAATGAGGGCGG + Intergenic
1007245754 6:40461109-40461131 GAAATTTTACACACTGGGCTGGG + Intronic
1007807169 6:44458958-44458980 AAAATTTCATACAATGAAATAGG + Intergenic
1008246831 6:49185897-49185919 CACTTTTCACACACTGGGCTTGG - Intergenic
1009298438 6:61984342-61984364 GAAATTTCACAAAAAAAGCTAGG - Intronic
1011034926 6:82963296-82963318 TAAATTCCACATAATGAGTTTGG - Intronic
1015178183 6:130334205-130334227 CCAATTTCAAGCAATGAGCGTGG - Intronic
1015740063 6:136444253-136444275 CAAATTTCATACATTGAGTTGGG - Intronic
1016749260 6:147614306-147614328 CAAAATACAAAAAATGAGCTGGG + Intronic
1017297036 6:152809631-152809653 CAAAATTTAGATAATGAGCTAGG + Intergenic
1017998328 6:159554486-159554508 AAAATTTAACAAAATTAGCTGGG - Intergenic
1020653843 7:10907182-10907204 CCCATTACACACAATGAGCCAGG + Intergenic
1021321209 7:19214491-19214513 CAAGTTTTACACATTGAGGTAGG + Intergenic
1021387724 7:20052338-20052360 CAAATTTTAAACAATGAAGTTGG + Intergenic
1021665648 7:22975875-22975897 CAAATTTTAAAAAATCAGCTGGG - Intronic
1022865682 7:34417223-34417245 CAAATTTGACACAATGCATTGGG + Intergenic
1024274118 7:47663935-47663957 CCAATTTCAGATAATGAGTTTGG - Intergenic
1024453373 7:49575421-49575443 CAAATTTCACCCAGGGAGCAAGG - Intergenic
1024598266 7:50958029-50958051 CAGATTTCCCGCAATGAGCCAGG - Intergenic
1025090910 7:56063736-56063758 CAAATTTCACCCAATAACCGTGG - Exonic
1026670445 7:72386235-72386257 CAAATTTTAAAAAATGATCTAGG + Intronic
1026799427 7:73390025-73390047 CAAATCTCAAACACTGACCTTGG - Intergenic
1027673031 7:81125902-81125924 CCAGTTTCATAGAATGAGCTGGG + Intergenic
1028841723 7:95435621-95435643 CAACTTACACACACTTAGCTAGG - Intergenic
1030864918 7:114689252-114689274 CAAATTTCAGAAAATAAACTGGG - Intronic
1031955779 7:127940780-127940802 CAAATTCCACACAAAGAGCCAGG - Intronic
1033971915 7:147051891-147051913 TAAATTTCAAACAAACAGCTTGG - Intronic
1034024333 7:147682394-147682416 TAAATTTCACATAATTAGATTGG - Intronic
1036019594 8:4829578-4829600 GAAAATTTACACAATTAGCTGGG + Intronic
1036237780 8:7056304-7056326 CAAATTTCACAGAAATATCTTGG + Intronic
1039687311 8:39818063-39818085 CAAACTTCACGAAATGAGTTGGG - Intronic
1039939867 8:42080927-42080949 CAAAGTACAAACAATTAGCTGGG - Intergenic
1040727643 8:50401968-50401990 CAAAATTCACACAAAGAAGTGGG - Intronic
1041609451 8:59827916-59827938 CAAATATCAAACATTGAGCTTGG - Intergenic
1042635678 8:70871217-70871239 TAAATTTCACCTACTGAGCTAGG + Intergenic
1043306268 8:78800455-78800477 CAAATTTTAAAAAATTAGCTGGG - Intronic
1043647590 8:82540250-82540272 GAAAATTCACAAAATGGGCTCGG - Intergenic
1043930919 8:86090981-86091003 AAAATTGTACAAAATGAGCTTGG + Intronic
1045081677 8:98631958-98631980 TAAATTACACACAAAAAGCTGGG - Intronic
1046468636 8:114638568-114638590 CAAATTCAAGACAATGAGCCAGG + Intergenic
1046930124 8:119833436-119833458 AAAATTACACAAAATTAGCTGGG + Intergenic
1047087052 8:121529390-121529412 CAAAGTTCAGATATTGAGCTTGG + Intergenic
1048946222 8:139450175-139450197 CCAAATTCACACAATGACGTAGG - Intergenic
1050778188 9:9295081-9295103 CAAATTTCTGAAAATAAGCTTGG + Intronic
1051568628 9:18529102-18529124 TAAATTTCACATAAGTAGCTAGG - Intronic
1053582639 9:39422956-39422978 CTAATTTCATAGAATGAGGTAGG + Intergenic
1053623465 9:39844168-39844190 CAAATTGTACACAATGACTTGGG + Intergenic
1053846821 9:42247801-42247823 CTAATTTCATAGAATGAGGTAGG + Intergenic
1053881403 9:42599060-42599082 CAAATTGTACACAATGACTTGGG - Intergenic
1054104218 9:60981699-60981721 CTAATTTCATAGAATGAGGTAGG + Intergenic
1054220434 9:62406531-62406553 CAAATTGTACACAATGACTTGGG - Intergenic
1054230281 9:62502641-62502663 CAAATTGTACACAATGACTTGGG + Intergenic
1054582126 9:66925151-66925173 CTAATTTCATAGAATGAGGTAGG - Intronic
1056038211 9:82631928-82631950 CAAACTTGAAATAATGAGCTTGG - Intergenic
1056879876 9:90380886-90380908 AAAATTACAAACAATTAGCTGGG - Intergenic
1057554352 9:96075765-96075787 CAAGTTTCACAGAAGCAGCTGGG - Intergenic
1057875379 9:98749560-98749582 CAAATGTCACCCTATGAGCCAGG + Intronic
1058078246 9:100672642-100672664 ATAATATCACACAATGAGATGGG + Intergenic
1058586390 9:106510903-106510925 CAACTTTCATACAAAGAGCAAGG - Intergenic
1061397317 9:130350239-130350261 TAAAATTCACATAATGGGCTGGG + Intronic
1185556934 X:1028974-1028996 CAAAGGCCACACAGTGAGCTGGG + Intergenic
1185967068 X:4618439-4618461 CAAATTTCACATAATGACTGAGG + Intergenic
1186897435 X:14018019-14018041 GACATTTTACAGAATGAGCTAGG - Intronic
1187088097 X:16063090-16063112 TCAATTTCAGACAATGAACTAGG + Intergenic
1189081874 X:37981603-37981625 CAAATTTTAAACATTGACCTAGG + Intronic
1189818877 X:44850514-44850536 CAAATGACACACAATAAACTGGG - Intergenic
1190243372 X:48675214-48675236 CAAATTTCCCTTAATTAGCTTGG - Intergenic
1190405623 X:50084540-50084562 AAAAATTCACAAAATCAGCTGGG - Intronic
1190565482 X:51726354-51726376 CAAATATCACAGATAGAGCTAGG - Intergenic
1191831178 X:65418261-65418283 GGAATTGTACACAATGAGCTAGG - Intronic
1194141750 X:90217729-90217751 CCAATTTCTCACAATAATCTGGG - Intergenic
1194680025 X:96841355-96841377 CAAATTGAACACAGTGAGCCAGG - Intronic
1194821416 X:98511305-98511327 CAAATTTCTTACAATAAGCATGG + Intergenic
1195039215 X:100998857-100998879 CATATTTCAGACACTGTGCTAGG + Intergenic
1195851027 X:109281372-109281394 CAAATCTGCCACATTGAGCTTGG + Intergenic
1197338789 X:125241156-125241178 CAAAATTTACAAAATGGGCTGGG + Intergenic
1197484714 X:127034254-127034276 CTAATTTCAAAGAATGAGTTAGG - Intergenic
1198513192 X:137374831-137374853 CAAATAACAATCAATGAGCTAGG - Intergenic
1200487501 Y:3786830-3786852 CCAATTTCTCACAATAATCTGGG - Intergenic
1201687633 Y:16725019-16725041 CAAATTTTAAAAAATTAGCTAGG - Intergenic