ID: 1065287340

View in Genome Browser
Species Human (GRCh38)
Location 10:24198875-24198897
Sequence AGTTCGGAGAGTACTGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065287340_1065287347 28 Left 1065287340 10:24198875-24198897 CCTAAAGCAGTACTCTCCGAACT 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1065287347 10:24198926-24198948 TTACATGAACAAGCCAGGTGTGG No data
1065287340_1065287342 -10 Left 1065287340 10:24198875-24198897 CCTAAAGCAGTACTCTCCGAACT 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1065287342 10:24198888-24198910 TCTCCGAACTACTAGGCCTTAGG No data
1065287340_1065287344 -7 Left 1065287340 10:24198875-24198897 CCTAAAGCAGTACTCTCCGAACT 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1065287344 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG No data
1065287340_1065287346 23 Left 1065287340 10:24198875-24198897 CCTAAAGCAGTACTCTCCGAACT 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065287340 Original CRISPR AGTTCGGAGAGTACTGCTTT AGG (reversed) Intronic
900567762 1:3342241-3342263 AGTTGGGAGAGTATTGTCTTAGG - Intronic
910254145 1:85230391-85230413 AGGTTGGGGAGTGCTGCTTTAGG + Intergenic
911060433 1:93743150-93743172 AGTTGAGAGATTACTGGTTTGGG + Intronic
911134281 1:94422490-94422512 AGGTTGGAGACTACTGCTCTAGG + Intronic
911847418 1:102771974-102771996 AGCTCTGAGAGTTCTGCATTGGG - Intergenic
916218081 1:162415688-162415710 AGTTGGGTGAGAACTGCTCTAGG + Intergenic
916383043 1:164234524-164234546 TGTTCGAGAAGTACTGCTTTAGG + Intergenic
916679789 1:167093941-167093963 AGTTAAGTGAGGACTGCTTTGGG + Intergenic
917706635 1:177641401-177641423 AATTCACAGAGTACTGCTCTAGG + Intergenic
921816644 1:219571543-219571565 AGTTTTGAGAGTACTGGTTGAGG + Intergenic
923199469 1:231697403-231697425 AGTGCTGTGAGTACTGATTTTGG - Intronic
1065287340 10:24198875-24198897 AGTTCGGAGAGTACTGCTTTAGG - Intronic
1065421657 10:25551532-25551554 AGTTCAGAAAATAGTGCTTTTGG + Intronic
1069838228 10:71322810-71322832 AGCTCGGAGACTGCTGCTTGTGG - Exonic
1077647773 11:3941254-3941276 AGTTCGAAGACTTCTGCTGTAGG + Intronic
1085807934 11:79653610-79653632 AGTTCAGAGAGTACAGGATTTGG + Intergenic
1086030960 11:82354769-82354791 AGTTCAGAGAGTAGGGCTGTGGG + Intergenic
1089142100 11:116293657-116293679 AGTTCAGAGATTAATGCTGTAGG + Intergenic
1093765479 12:22957083-22957105 AGTTAAAAGAGTACTGGTTTGGG + Intergenic
1094627453 12:32137432-32137454 GTATCTGAGAGTACTGCTTTGGG - Intronic
1099505108 12:83464869-83464891 AGTTCTTAAAATACTGCTTTAGG - Intergenic
1101122940 12:101602572-101602594 ATTTCTGAGTTTACTGCTTTAGG - Intronic
1106945087 13:34818504-34818526 AGTTCTGAGACTACTGGTGTGGG + Intergenic
1107327918 13:39264827-39264849 AGGTCAGAGAGTGCTGCTCTAGG - Intergenic
1108279701 13:48849331-48849353 AGTTTGGAAAGCACTGCTTTAGG - Intergenic
1112777711 13:102863625-102863647 ATTGCGGTGAGTACTGATTTTGG - Intronic
1119444662 14:74653246-74653268 AGTTCTGAGATTACTCCCTTAGG + Intergenic
1128401118 15:67281913-67281935 AGATAGGAGAGGGCTGCTTTGGG - Intronic
1132385164 15:101395228-101395250 AGTTTGGGGAGCACTGTTTTTGG - Intronic
1133334624 16:4998910-4998932 AGTTCTGTGAATACTGATTTGGG - Intronic
1137882601 16:52067552-52067574 TGTTCTCAGAGTAGTGCTTTAGG - Intronic
1141342076 16:83212702-83212724 AGTTTGAAGACCACTGCTTTGGG - Intronic
1149515916 17:57280865-57280887 ACTTCGGAGACCACTGCTTTTGG + Intronic
1149529651 17:57384659-57384681 AGTTCAGTGAGTGGTGCTTTGGG + Intronic
1149668640 17:58385172-58385194 AGATCAGAGAGTACATCTTTAGG - Intronic
1150918247 17:69457918-69457940 AGTTCGGGAAGCACTGCTCTAGG + Intronic
1165135280 19:33664099-33664121 AGTTCGGAGTGGACTGGATTGGG + Intronic
929632381 2:43477186-43477208 AGTTTGGGGAATACTGCTGTCGG - Intronic
934187255 2:89758192-89758214 AGTCCACAGAGTACAGCTTTGGG + Intergenic
937680883 2:124643196-124643218 ACTTAGGAGAGGACTGCATTTGG - Intronic
938547258 2:132345906-132345928 AGTTGGGAGAGTCATGCATTTGG - Intergenic
940290487 2:152073760-152073782 AGTTCTGAGAGCCCTGCTCTTGG - Intronic
1170917165 20:20638420-20638442 AGTTCTCAGAGCACAGCTTTTGG - Intronic
1171191524 20:23162730-23162752 AGTTCAGAGGGTCCTGCTTGGGG + Intergenic
1171590603 20:26596389-26596411 AGTTCTGAGAATGCTGCTGTCGG - Intergenic
1171876129 20:30578665-30578687 AGTTGGGAGAGTCATGCATTTGG - Intergenic
1177308136 21:19348063-19348085 AGTTTGGAGAGTACTACATGGGG + Intergenic
1178616762 21:34141354-34141376 AGCTAGGAGGGTGCTGCTTTAGG + Intronic
1179267222 21:39814399-39814421 AGTTAGGATTGAACTGCTTTAGG - Intergenic
1181263495 22:21615703-21615725 AGTGCCGAGAGTATTGATTTTGG - Intronic
955718371 3:61855290-61855312 GGTTCTGAGAGAACTGCTTGAGG - Intronic
956581988 3:70824204-70824226 AGTTTGCAGAGTATTGTTTTAGG - Intergenic
957181184 3:76879991-76880013 AGTTCTCAGAGTAATGATTTAGG + Intronic
960807374 3:121597299-121597321 AATTCAAATAGTACTGCTTTAGG - Intronic
967613553 3:191537430-191537452 AGTGCTGAGAGCACTGCTCTGGG + Intergenic
970031639 4:11682650-11682672 AGTTATTAGATTACTGCTTTTGG - Intergenic
970524356 4:16916542-16916564 GGTCCGGAGAATCCTGCTTTGGG + Intergenic
971099231 4:23444709-23444731 TGGACGGATAGTACTGCTTTGGG + Intergenic
975563810 4:75732904-75732926 AGTTGGGGGAGTTCTGTTTTAGG + Intronic
977934714 4:102788318-102788340 AATTCTGGAAGTACTGCTTTTGG + Intergenic
982714470 4:158792200-158792222 AGTGCCGAGAGTATTGATTTTGG - Intronic
983863922 4:172740486-172740508 AGCTCAGTGAGTACTGATTTGGG - Intronic
984664855 4:182415386-182415408 ATTTCAGAGAGTACTAATTTTGG - Intronic
987709307 5:21488419-21488441 AGTGCTGTGAGTACTGATTTGGG - Intergenic
989068385 5:37485309-37485331 AGTGCTGTGAGTACTGATTTTGG - Intronic
991738566 5:69648940-69648962 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991759630 5:69907482-69907504 AGTGCTGTGAGTACTGATTTGGG - Intergenic
991787704 5:70210630-70210652 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991790141 5:70228680-70228702 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991814889 5:70503777-70503799 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991818025 5:70525055-70525077 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991838859 5:70782548-70782570 AGTGCTGTGAGTACTGATTTGGG - Intergenic
991880149 5:71210997-71211019 AGTGCTGTGAGTACTGATTTGGG + Intergenic
991882589 5:71229023-71229045 AGTGCTGTGAGTACTGATTTGGG + Intergenic
994421429 5:99529751-99529773 AGTGCTGTGAGTACTGATTTGGG - Intergenic
994485615 5:100384560-100384582 AGTGCTGTGAGTACTGATTTGGG + Intergenic
996608345 5:125350223-125350245 AAAACGGATAGTACTGCTTTTGG + Intergenic
1001202118 5:169727810-169727832 AGTTTGGAAACTTCTGCTTTTGG + Intronic
1003230586 6:4249289-4249311 AGGTAGGAGAGTTCTGCTTCTGG - Intergenic
1005110968 6:22281322-22281344 AGTTTGGAGATTAATGCTTCAGG + Intergenic
1005548374 6:26892043-26892065 AGTGCTGTGAGTACTGATTTGGG + Intergenic
1007296776 6:40829332-40829354 AGGTTGGGGACTACTGCTTTAGG - Intergenic
1009019132 6:57933153-57933175 AGTGCTGTGAGTACTGATTTGGG + Intergenic
1009531980 6:64829659-64829681 AGTTCGGAGATGAAAGCTTTTGG + Intronic
1010267946 6:73888287-73888309 ATTTCTTTGAGTACTGCTTTAGG + Intergenic
1017932570 6:158971338-158971360 AGTTCTGAAAATACTGATTTTGG + Intergenic
1022692902 7:32675208-32675230 AGTCCGTAGACTACTGCTTAAGG - Intergenic
1031929666 7:127672069-127672091 AGTGCTGAGAGTATTGATTTGGG + Intronic
1038421987 8:27439393-27439415 TGTTCGGTGAGTGCTGATTTGGG + Exonic
1041033080 8:53757756-53757778 GGTGGGGAGAGTACTGCCTTAGG - Intronic
1046822191 8:118646377-118646399 AGTTCTGAGACTAGTGTTTTGGG + Intergenic
1052107833 9:24542189-24542211 AGTTTCGAGAGTCCTGCTTCAGG - Intergenic
1187986925 X:24823850-24823872 GGTTCAGAGAGTAATGTTTTTGG + Intronic
1194959660 X:100220665-100220687 AGTTTGGAGACTCCTGATTTAGG - Intergenic
1195391654 X:104368575-104368597 GGTTCTGAAAGTACTGCCTTGGG + Intergenic
1199807366 X:151313613-151313635 AGTTCGGGGTGATCTGCTTTTGG - Intergenic