ID: 1065287343

View in Genome Browser
Species Human (GRCh38)
Location 10:24198891-24198913
Sequence CCTCCTAAGGCCTAGTAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065287343_1065287347 12 Left 1065287343 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1065287347 10:24198926-24198948 TTACATGAACAAGCCAGGTGTGG No data
1065287343_1065287348 15 Left 1065287343 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1065287348 10:24198929-24198951 CATGAACAAGCCAGGTGTGGTGG No data
1065287343_1065287346 7 Left 1065287343 10:24198891-24198913 CCGAACTACTAGGCCTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065287343 Original CRISPR CCTCCTAAGGCCTAGTAGTT CGG (reversed) Intronic
905248537 1:36631136-36631158 TCTCCTAACCCCTAGTAGTGAGG - Intergenic
906189233 1:43885302-43885324 GATCCTACAGCCTAGTAGTTTGG - Intronic
909765126 1:79346089-79346111 CCTCCAAAAACCTAGCAGTTAGG + Intergenic
912698428 1:111858370-111858392 CCTCCAAAGGCCTATGAGATAGG + Intronic
913234465 1:116767898-116767920 CCTCCTAAGGCCAAGAACATAGG + Intronic
916160075 1:161902492-161902514 TATACTAAGGCCTAGCAGTTTGG + Intronic
919722843 1:200858045-200858067 CCCACTAAGGCATAGAAGTTGGG + Exonic
1065287343 10:24198891-24198913 CCTCCTAAGGCCTAGTAGTTCGG - Intronic
1069597344 10:69681061-69681083 TCTCTTAAGGCTTAGAAGTTTGG - Intergenic
1069644439 10:69982416-69982438 CCACCTCAGCCCTAGTAGCTGGG - Intergenic
1073489979 10:103846745-103846767 CCACCTTAGGCCTAGTTGGTTGG - Intronic
1077669935 11:4147906-4147928 CTTCCTAAGTCCTCGTAGATTGG + Intergenic
1078508684 11:11969581-11969603 CCTCCTGAGGCCTGGTATTCTGG + Intronic
1083458947 11:62798310-62798332 CCTCCTGAGCCCAAGTAGCTGGG - Intronic
1084567899 11:69942074-69942096 CCTTCTCAGGCCAAGTGGTTAGG + Intergenic
1088028968 11:105222867-105222889 CCTCCCAAGTCCTAGTATTATGG - Intergenic
1095260700 12:40095563-40095585 CCTCCAAGTGCCTAGTAATTGGG - Intronic
1106670843 13:31903352-31903374 CCTCCCAAGGTCTGGGAGTTTGG + Intergenic
1114334578 14:21675058-21675080 TCTCCTAAGGCCTTGTGGCTTGG + Intergenic
1117298383 14:54398839-54398861 CCCCACATGGCCTAGTAGTTTGG - Intronic
1118290192 14:64513580-64513602 CTTCCTAAAGCCTACTATTTTGG + Intronic
1125735608 15:41923321-41923343 CCTCCTAAGGCTGAATAGGTCGG + Intronic
1131379898 15:91954893-91954915 CCTCCTAATTCCTAGGAATTAGG + Intronic
1137940502 16:52679024-52679046 CATCCCTAGGCCAAGTAGTTAGG + Intergenic
1138149689 16:54644632-54644654 CCTCCTACAGCCGAGTAGTGAGG - Intergenic
1139342690 16:66278710-66278732 CCTGCTCAGGCCTAGAGGTTGGG - Intergenic
1139702978 16:68720735-68720757 CCTCCCAAGCCCGAGTAGCTGGG + Intronic
1141195883 16:81860853-81860875 CCTCCTGAGGCTGAGTAGCTGGG - Intronic
1143293079 17:5847680-5847702 CCTCCTTAGGCTTAGAACTTTGG + Intronic
1147059843 17:37866658-37866680 CCTCCCAAGCCCAAGTAGCTGGG - Intergenic
1155564080 18:27113514-27113536 CCTCCCAAGGCCTTGGGGTTAGG - Intronic
1156594078 18:38525805-38525827 CCTCCTAACGCCTACTCCTTAGG - Intergenic
1158263789 18:55637461-55637483 CCTGATAAGACCTATTAGTTTGG - Intronic
1162188009 19:8922235-8922257 CCACCTAAGGGATAGGAGTTTGG + Intronic
1167580315 19:50337435-50337457 CCTCCTCAGGCCCAGTATTTTGG - Intronic
1168112907 19:54204510-54204532 CCTCCTCAGCTCTAGTAGCTGGG + Intronic
927206661 2:20615411-20615433 CACCCTAAGGCCTTGCAGTTGGG - Intronic
932196650 2:69789698-69789720 CCTCCTAGGGTCCAGTGGTTTGG + Intronic
941208885 2:162610397-162610419 TCTCCCAAGGCCTAGGATTTAGG + Intronic
944396083 2:199267746-199267768 CCTCCTGGGGCCTGGAAGTTAGG + Intergenic
1170069641 20:12351597-12351619 CCTCCAAGGGCCTAGTCCTTCGG + Intergenic
1170677161 20:18493172-18493194 CCTTATAAGGCCTAGTGGGTAGG - Intronic
1171041629 20:21769466-21769488 CCTCCCAAGTCCAAGTAGTCGGG + Intergenic
1174108563 20:48181233-48181255 CCACCAAAGGCCTAAAAGTTGGG + Intergenic
1175142054 20:56868007-56868029 ACTCATAAGTCTTAGTAGTTAGG - Intergenic
949383605 3:3473684-3473706 CCTCATAAGGGCTAGGACTTGGG - Intergenic
950328509 3:12136621-12136643 CCTCACAAGCCCTAGTTGTTAGG + Intronic
954269466 3:49496283-49496305 CCACCTCAGGCCAAGTAGCTGGG + Intronic
959844237 3:111014504-111014526 AGTCAAAAGGCCTAGTAGTTAGG - Intergenic
961542721 3:127610955-127610977 CCTCCTAGGGCCAAGTTGTAGGG + Intronic
963205383 3:142629316-142629338 CCTCCTAAGCCTGAGTAGCTGGG + Intronic
976478428 4:85511334-85511356 CCTCCGAAGGCTTTGGAGTTAGG + Intronic
981873294 4:149511977-149511999 CATCCTAAGTCCTAGGTGTTGGG + Intergenic
985000310 4:185475796-185475818 CCTCCCAAGCCCAAGTAGCTGGG - Intergenic
989287299 5:39716583-39716605 CCACCTAAGGCCCAGTAGGGAGG + Intergenic
989412367 5:41135073-41135095 CCTGCTAAGTCCCAGGAGTTAGG - Intergenic
990026792 5:51201917-51201939 CTTCCTAAGGGCTTGCAGTTTGG + Intergenic
992261614 5:74976370-74976392 CCTCCTTGGGTCTAGAAGTTAGG + Intergenic
998740008 5:145189826-145189848 TCTGCTAAGGCCTAATAGTCTGG - Intergenic
1005707730 6:28472101-28472123 GCTCCCAAGGCCTATTATTTTGG + Intergenic
1007929710 6:45679227-45679249 CCTCATAAGGGCTCGTTGTTAGG + Intergenic
1020637490 7:10714246-10714268 TCTCTTAAGGCCCAGGAGTTTGG - Intergenic
1022922260 7:35027385-35027407 CCTACCAAGGCTTTGTAGTTCGG - Intronic
1030229577 7:107193134-107193156 CCGCCTGAGGCCTAGAAGGTTGG - Intronic
1035594229 8:842160-842182 CGACCTAAGGACGAGTAGTTAGG - Intergenic
1036507241 8:9366846-9366868 CCTCCTAGGGCCTAGGGGATGGG - Intergenic
1039371967 8:36994227-36994249 TCTTCTGAGGCCTAGTAGGTGGG - Intergenic
1043134472 8:76504035-76504057 CCTTCTAAGGCCTGATTGTTAGG + Intergenic
1043436783 8:80242749-80242771 CCTCCTAATGACTAGTATTTTGG - Intergenic
1046757347 8:117985376-117985398 CCTGTTAATGCCTTGTAGTTCGG + Intronic
1050886543 9:10773636-10773658 CCTCCTGTGGCCTGGTAGGTAGG + Intergenic
1051503960 9:17807792-17807814 CCTCCTGAGGCCTATTACATAGG - Intergenic
1053101666 9:35376647-35376669 CCTCCTAAAGCCTAGAATCTAGG + Intronic
1058739176 9:107925266-107925288 CCACCTCAGCCCAAGTAGTTGGG - Intergenic
1061023347 9:128031368-128031390 CCTCCCAAGCCCAAGTAGCTAGG + Intergenic
1194444508 X:93971561-93971583 CCTCCTAAGGCCTACTATTGAGG + Intergenic
1194993141 X:100566584-100566606 CCTCCTGAGCCCAAGTAGCTGGG - Intergenic
1196467543 X:115988084-115988106 CCCCCTAAGGCCTAATATTTGGG - Intergenic
1199539456 X:148942935-148942957 CTTCTTCAGGCCTAGTAATTAGG - Intronic